ATP6V0E2 (NM_001100592) Human Untagged Clone

CAT#: SC316681

ATP6V0E2 (untagged)-Human ATPase, H+ transporting V0 subunit e2 (ATP6V0E2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATP6V0E2
• Synonyms: ATP6V0E2L; C7orf32
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001100592, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGCGTGCGCGGCCCGGCCCGGCTGATCGCTTCGGGTGCTCGACTCCTGTTGCGCATGCTCAGCGCGC
  TGCCCGGCTGGGGACCCGCGCACCTGCAGCGCCCGCTGCTCGGCCCTGCATCCTGCCTGGGCATCCTGCG
  CCCGGCCATGACGGCGCACTCATTCGCCCTCCCGGTCATCATCTTCACCACGTTCTGGGGCCTCGTCGGC
  ATCGCCGGGCCCTGGTTCGTGCCGAAGGGACCCAACCGCGGAGTGATCATCACCATGCTGGTCGCCACCG
  CCGTCTGCTGTTACCTCTTGTGCCCAGCTCTCGGAATGACTGTGGCTCCACTGTCCCTGACAACCCCTTC
  GTCCGGACCCTCCCCCACACAACTATGTCTGGTCACCAGCTCCCTCCTGCTGGCACCCAGAGACCCGGAC
  CCGCAGGGCCTGCCTGGTTCCTGGAAGTCTTCCCAGTCTTCCCAGCCAGCCCGGGCCCTGGGGAGCCCTG
  GGCACAGCAGCGGCCGAGGGGATGTCCTGCTCCAATACCCGCACTGCTCTGGAGTTTGCCCTCTTTCCCA
  AGGAGATGCTGCTGGGGAGCTGGTATGGGTGGGGTCTTTCCCTTTACAGACGGGGCAGATGCCAGGACTC
  AGCCCATCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001100592
• ORF Size: 642 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001100592.2, NP_001094062.1
• RefSeq Size: 2635
• RefSeq ORF: 642
• Locus ID: 155066
• Protein Pathways: Epithelial cell signaling in Helicobacter pylori infection, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection
• Gene Summary: Multisubunit vacuolar-type proton pumps, or H(+)-ATPases, acidify various intracellular compartments, such as vacuoles, clathrin-coated and synaptic vesicles, endosomes, lysosomes, and chromaffin granules. H(+)-ATPases are also found in plasma membranes of specialized cells, where they play roles in urinary acidification, bone resorption, and sperm maturation. Multiple subunits form H(+)-ATPases, with proteins of the V1 class hydrolyzing ATP for energy to transport H+, and proteins of the V0 class forming an integral membrane domain through which H+ is transported. ATP6V0E2 encodes an isoform of the H(+)-ATPase V0 e subunit, an essential proton pump component (Blake-Palmer et al., 2007 [PubMed 17350184]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (2) lacks an alternate segment in the 3' coding region, compared to variant 1, that causes a frameshift. The resulting protein (isoform 2) has a longer and distinct C-terminus, compared to isoform 1.