CRSP9 (MED7) (NM_001100816) Human Untagged Clone
CAT#: SC316688
MED7 (untagged)-Human mediator complex subunit 7 (MED7), transcript variant 1
"NM_001100816" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MED7 |
Synonyms | ARC34; CRSP9; CRSP33 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001100816, the custom clone sequence may differ by one or more nucleotides
ATGGGTGAACCACAGCAAGTGAGTGCACTTCCACCACCTCCAATGCAATATATCAAGGAATATACGGATG AAAATATTCAAGAAGGCTTAGCTCCCAAGCCTCCCCCTCCAATAAAAGACAGTTACATGATGTTTGGCAA TCAGTTCCAATGTGATGATCTTATCATCCGCCCTTTGGAAAGTCAGGGCATCGAACGGCTTCATCCTATG CAGTTTGATCACAAGAAAGAACTGAGAAAACTTAATATGTCTATCCTTATTAATTTCTTGGACCTTTTAG ATATTTTAATAAGGAGCCCTGGGAGTATAAAACGAGAAGAGAAACTAGAAGATCTTAAGCTGCTTTTTGT ACACGTGCATCATCTTATAAATGAATACCGACCCCACCAAGCAAGAGAGACCTTGAGAGTCATGATGGAG GTCCAGAAACGTCAACGGCTTGAAACAGCTGAGAGATTTCAAAAGCACCTGGAACGAGTAATTGAAATGA TTCAGAATTGCTTGGCTTCTTTGCCTGATGATTTGCCTCATTCAGAAGCAGGAATGAGAGTAAAAACTGA ACCAATGGATGCTGATGATAGCAACAATTGTACTGGACAGAATGAACATCAAAGAGAAAATTCAGGTCAT AGGAGAGATCAGATTATAGAGAAAGATGCTGCCTTGTGTGTCCTAATTGATGAGATGAATGAAAGACCAT GA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001100816 |
ORF Size | 702 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001100816.1, NP_001094286.1 |
RefSeq Size | 1400 |
RefSeq ORF | 702 |
Locus ID | 9443 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript. Both variants encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212508 | MED7 (Myc-DDK-tagged)-Human mediator complex subunit 7 (MED7), transcript variant 1 |
USD 98.00 |
|
RG212508 | MED7 (GFP-tagged) - Human mediator complex subunit 7 (MED7), transcript variant 1 |
USD 460.00 |
|
RC212508L3 | Lenti ORF clone of Human mediator complex subunit 7 (MED7), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC212508L4 | Lenti ORF clone of Human mediator complex subunit 7 (MED7), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review