CRSP9 (MED7) (NM_001100816) Human Untagged Clone

CAT#: SC316688

MED7 (untagged)-Human mediator complex subunit 7 (MED7), transcript variant 1


  "NM_001100816" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MED7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MED7
Synonyms ARC34; CRSP9; CRSP33
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001100816, the custom clone sequence may differ by one or more nucleotides


ATGGGTGAACCACAGCAAGTGAGTGCACTTCCACCACCTCCAATGCAATATATCAAGGAATATACGGATG
AAAATATTCAAGAAGGCTTAGCTCCCAAGCCTCCCCCTCCAATAAAAGACAGTTACATGATGTTTGGCAA
TCAGTTCCAATGTGATGATCTTATCATCCGCCCTTTGGAAAGTCAGGGCATCGAACGGCTTCATCCTATG
CAGTTTGATCACAAGAAAGAACTGAGAAAACTTAATATGTCTATCCTTATTAATTTCTTGGACCTTTTAG
ATATTTTAATAAGGAGCCCTGGGAGTATAAAACGAGAAGAGAAACTAGAAGATCTTAAGCTGCTTTTTGT
ACACGTGCATCATCTTATAAATGAATACCGACCCCACCAAGCAAGAGAGACCTTGAGAGTCATGATGGAG
GTCCAGAAACGTCAACGGCTTGAAACAGCTGAGAGATTTCAAAAGCACCTGGAACGAGTAATTGAAATGA
TTCAGAATTGCTTGGCTTCTTTGCCTGATGATTTGCCTCATTCAGAAGCAGGAATGAGAGTAAAAACTGA
ACCAATGGATGCTGATGATAGCAACAATTGTACTGGACAGAATGAACATCAAAGAGAAAATTCAGGTCAT
AGGAGAGATCAGATTATAGAGAAAGATGCTGCCTTGTGTGTCCTAATTGATGAGATGAATGAAAGACCAT
GA


Restriction Sites SgfI-MluI     
ACCN NM_001100816
ORF Size 702 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001100816.1, NP_001094286.1
RefSeq Size 1400
RefSeq ORF 702
Locus ID 9443
Protein Families Druggable Genome, Transcription Factors
Gene Summary The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript. Both variants encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.