ICAM2 (NM_001099786) Human Untagged Clone

CAT#: SC316701

ICAM2 (untagged)-Human intercellular adhesion molecule 2 (ICAM2), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ICAM2
• Synonyms: CD102
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001099786, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCTCTTTCGGTTACAGGACCCTGACTGTGGCCCTCTTCACCCTGATCTGCTGTCCAGGATCGGATG
  AGAAGGTATTCGAGGTACACGTGAGGCCAAAGAAGCTGGCGGTTGAGCCCAAAGGGTCCCTCGAGGTCAA
  CTGCAGCACCACCTGTAACCAGCCTGAAGTGGGTGGTCTGGAGACCTCTCTAGATAAGATTCTGCTGGAC
  GAACAGGCTCAGTGGAAACATTACTTGGTCTCAAACATCTCCCATGACACGGTCCTCCAATGCCACTTCA
  CCTGCTCCGGGAAGCAGGAGTCAATGAATTCCAACGTCAGCGTGTACCAGCCTCCAAGGCAGGTCATCCT
  GACACTGCAACCCACTTTGGTGGCTGTGGGCAAGTCCTTCACCATTGAGTGCAGGGTGCCCACCGTGGAG
  CCCCTGGACAGCCTCACCCTCTTCCTGTTCCGTGGCAATGAGACTCTGCACTATGAGACCTTCGGGAAGG
  CAGCCCCTGCTCCGCAGGAGGCCACAGCCACATTCAACAGCACGGCTGACAGAGAGGATGGCCACCGCAA
  CTTCTCCTGCCTGGCTGTGCTGGACTTGATGTCTCGCGGTGGCAACATCTTTCACAAACACTCAGCCCCG
  AAGATGTTGGAGATCTATGAGCCTGTGTCGGACAGCCAGATGGTCATCATAGTCACGGTGGTGTCGGTGT
  TGCTGTCCCTGTTCGTGACATCTGTCCTGCTCTGCTTCATCTTCGGCCAGCACTTGCGCCAGCAGCGGAT
  GGGCACCTACGGGGTGCGAGCGGCTTGGAGGAGGCTGCCCCAGGCCTTCCGGCCATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001099786
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001099786.1, NP_001093256.1
• RefSeq Size: 1352 bp
• RefSeq ORF: 828 bp
• Locus ID: 3384
• Cytogenetics: 17q23.3
• Protein Families: ES Cell Differentiation/IPS, Transmembrane
• Protein Pathways: Cell adhesion molecules (CAMs), Natural killer cell mediated cytotoxicity
• Gene Summary: 'The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein may play a role in lymphocyte recirculation by blocking LFA-1-dependent cell adhesion. It mediates adhesive interactions important for antigen-specific immune response, NK-cell mediated clearance, lymphocyte recirculation, and other cellular interactions important for immune response and surveillance. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (1) represents the longest transcript. All 5 variants encode the same protein.