CENPN (NM_001100624) Human Untagged Clone

CAT#: SC316725

CENPN (untagged)-Human centromere protein N (CENPN), transcript variant 2


  "NM_001100624" in other vectors (4)

Reconstitution Protocol

USD 580.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CENPN"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CENPN
Synonyms BM039; C16orf60; CENP-N; ICEN32
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001100624, the custom clone sequence may differ by one or more nucleotides


ATGGATGAGACTGTTGCTGAGTTCATCAAGAGGACCATCTTGAAAATCCCCATGAATGAACTGACAACAA
TCCTGAAGGCCTGGGATTTTTTGTCTGAAAATCAACTGCAGACTGTAAATTTCCGACAGAGAAAGGAATC
TGTAGTTCAGCACTTGATCCATCTGTGTGAGGAAAAGCGTGCAAGTATCAGTGATGCTGCCCTGTTAGAC
ATCATTTATATGCAATTTCATCAGCACCAGAAAGTTTGGGAAGTTTTTCAGATGAGTAAAGGACCAGGTG
AAGATGTTGACCTTTTTGATATGAAACAATTTAAAAATTCGTTCAAGAAAATTCTTCAGAGAGCATTAAA
AAATGTGACAGTCAGCTTCAGAGAAACTGAGGAGAATGCAGTCTGGATTCGAATTGCCTGGGGAACACAG
TACACAAAGCCAAACCAGTACAAACCTACCTACGTGGTGTACTACTCCCAGACTCCGTACGCCTTCACGT
CCTCCTCCATGCTGAGGCGCAATACACCGCTTCTGGGTCAGGCGCTGACAATTGCTAGCAAACACCATCA
GATTGTGAAAATGGACCTGAGAAGTCGGTATCTGGACTCTCTTAAGGCTATTGTTTTTAAACAGTATAAT
CAGACCTTTGAAACTCACAACTCTACGACACCTCTACAGGAAAGAAGCCTTGGACTAGATATAAATATGG
ATTCAAGGATCATTCATGAAAACATAGTAGAAAAAGAGAGAGTCCAACGAATAACTCAAGAAACATTTGG
AGATTATCCTCAACCACAACTAGAATTTGCACAATATAAGCTTGAAACGAAATTCAAAAGTGGTTTAAAT
GGGAGCATCTTGGCTGAGAGGGAAGAACCCCTCCGATGCCTAATAAAGTTCTCTAGCCCACATCTTCTGG
AAGCATTGAAATCCTTAGCACCAGCGGGTATTGCAGATGCTCCACTTTCTCCACTGCTCACTTGCATACC
CAACAAGAGAATGAATTATTTTAAAATTAGAGATAAATAA


Restriction Sites SgfI-MluI     
ACCN NM_001100624
ORF Size 1020 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001100624.2, NP_001094094.2
RefSeq Size 4663
RefSeq ORF 1020
Locus ID 55839
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene forms part of the nucleosome-associated complex and is important for kinetochore assembly. It is bound to kinetochores during S phase and G2 and recruits other proteins to the centromere. Pseudogenes of this gene are located on chromosome 2. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (2) uses an alternate 3' terminal exon compared to variant 1. The resulting protein (isoform 2) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.