CENPN (NM_001100624) Human Untagged Clone
CAT#: SC316725
CENPN (untagged)-Human centromere protein N (CENPN), transcript variant 2
"NM_001100624" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CENPN |
Synonyms | BM039; C16orf60; CENP-N; ICEN32 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001100624, the custom clone sequence may differ by one or more nucleotides
ATGGATGAGACTGTTGCTGAGTTCATCAAGAGGACCATCTTGAAAATCCCCATGAATGAACTGACAACAA TCCTGAAGGCCTGGGATTTTTTGTCTGAAAATCAACTGCAGACTGTAAATTTCCGACAGAGAAAGGAATC TGTAGTTCAGCACTTGATCCATCTGTGTGAGGAAAAGCGTGCAAGTATCAGTGATGCTGCCCTGTTAGAC ATCATTTATATGCAATTTCATCAGCACCAGAAAGTTTGGGAAGTTTTTCAGATGAGTAAAGGACCAGGTG AAGATGTTGACCTTTTTGATATGAAACAATTTAAAAATTCGTTCAAGAAAATTCTTCAGAGAGCATTAAA AAATGTGACAGTCAGCTTCAGAGAAACTGAGGAGAATGCAGTCTGGATTCGAATTGCCTGGGGAACACAG TACACAAAGCCAAACCAGTACAAACCTACCTACGTGGTGTACTACTCCCAGACTCCGTACGCCTTCACGT CCTCCTCCATGCTGAGGCGCAATACACCGCTTCTGGGTCAGGCGCTGACAATTGCTAGCAAACACCATCA GATTGTGAAAATGGACCTGAGAAGTCGGTATCTGGACTCTCTTAAGGCTATTGTTTTTAAACAGTATAAT CAGACCTTTGAAACTCACAACTCTACGACACCTCTACAGGAAAGAAGCCTTGGACTAGATATAAATATGG ATTCAAGGATCATTCATGAAAACATAGTAGAAAAAGAGAGAGTCCAACGAATAACTCAAGAAACATTTGG AGATTATCCTCAACCACAACTAGAATTTGCACAATATAAGCTTGAAACGAAATTCAAAAGTGGTTTAAAT GGGAGCATCTTGGCTGAGAGGGAAGAACCCCTCCGATGCCTAATAAAGTTCTCTAGCCCACATCTTCTGG AAGCATTGAAATCCTTAGCACCAGCGGGTATTGCAGATGCTCCACTTTCTCCACTGCTCACTTGCATACC CAACAAGAGAATGAATTATTTTAAAATTAGAGATAAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001100624 |
ORF Size | 1020 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001100624.2, NP_001094094.2 |
RefSeq Size | 4663 |
RefSeq ORF | 1020 |
Locus ID | 55839 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene forms part of the nucleosome-associated complex and is important for kinetochore assembly. It is bound to kinetochores during S phase and G2 and recruits other proteins to the centromere. Pseudogenes of this gene are located on chromosome 2. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (2) uses an alternate 3' terminal exon compared to variant 1. The resulting protein (isoform 2) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219371 | CENPN (Myc-DDK-tagged)-Human centromere protein N (CENPN), transcript variant 2 |
USD 420.00 |
|
RG219371 | CENPN (GFP-tagged) - Human centromere protein N (CENPN), transcript variant 2 |
USD 460.00 |
|
RC219371L3 | Lenti-ORF clone of CENPN (Myc-DDK-tagged)-Human centromere protein N (CENPN), transcript variant 2 |
USD 620.00 |
|
RC219371L4 | Lenti-ORF clone of CENPN (mGFP-tagged)-Human centromere protein N (CENPN), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review