CCR5 (NM_001100168) Human Untagged Clone
CAT#: SC316730
CCR5 (untagged)-Human chemokine (C-C motif) receptor 5 (CCR5), transcript variant B
"NM_001100168" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CCR5 |
| Synonyms | CC-CKR-5; CCCKR5; CCR-5; CD195; CKR-5; CKR5; CMKBR5; IDDM22 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF within SC316730 sequence for NM_001100168 edited (data generated by NextGen Sequencing)
ATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGCCAAAAAATCA ATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTGTTCATCTTTGGTTTTGTGGG CAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTC AACCTGGCCATCTCTGACCTGTTTTTCCTTCTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGT GGGACTTTGGAAATACAATGTGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCTT CTTCATCATCCTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTAAAAGCCAGG ACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCTCTCCCAGGAA TCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCATTTTCCATACAGTCAGTA TCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATG GTCATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTG TGAGGCTTATCTTCACCATCATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCT GAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAG GTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTCGGGGAGAAGT TCAGAAACTACCTCTTAGTCTTCTTCCAAAAGCACATTGCCAAACGCTTCTGCAAATGCTGTTCTATTTT CCAGCAAGAGGCTCCCGAGCGAGCAAGCTCAGTTTACACCCGATCCACTGGGGAGCAGGAAATATCTGTG GGCTTGTGA Clone variation with respect to NM_001100168.1 |
| Restriction Sites | Please inquire |
| ACCN | NM_001100168 |
| Insert Size | 1200 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_001100168.1. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001100168.1, NP_001093638.1 |
| RefSeq Size | 3451 bp |
| RefSeq ORF | 1059 bp |
| Locus ID | 1234 |
| Cytogenetics | 3p21.31 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, GPCR, Transmembrane |
| Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction, Endocytosis |
| Gene Summary | 'This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. This protein is expressed by T cells and macrophages, and is known to be an important co-receptor for macrophage-tropic virus, including HIV, to enter host cells. Defective alleles of this gene have been associated with the HIV infection resistance. The ligands of this receptor include monocyte chemoattractant protein 2 (MCP-2), macrophage inflammatory protein 1 alpha (MIP-1 alpha), macrophage inflammatory protein 1 beta (MIP-1 beta) and regulated on activation normal T expressed and secreted protein (RANTES). Expression of this gene was also detected in a promyeloblastic cell line, suggesting that this protein may play a role in granulocyte lineage proliferation and differentiation. This gene is located at the chemokine receptor gene cluster region. An allelic polymorphism in this gene results in both functional and non-functional alleles; the reference genome represents the functional allele. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2015]' Transcript Variant: This variant (B) differs in the 5' UTR compared to variant A. Both variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by published experimental evidence. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216008 | CCR5 (Myc-DDK-tagged)-Human chemokine (C-C motif) receptor 5 (CCR5), transcript variant B |
USD 420.00 |
|
| RG216008 | CCR5 (GFP-tagged) - Human chemokine (C-C motif) receptor 5 (CCR5), transcript variant B |
USD 460.00 |
|
| RC216008L3 | Lenti-ORF clone of CCR5 (Myc-DDK-tagged)-Human chemokine (C-C motif) receptor 5 (CCR5), transcript variant B |
USD 620.00 |
|
| RC216008L4 | Lenti-ORF clone of CCR5 (mGFP-tagged)-Human chemokine (C-C motif) receptor 5 (CCR5), transcript variant B |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China