ARL17B (NM_001103154) Human Untagged Clone

CAT#: SC316895

ARL17B (untagged)-Human ADP-ribosylation factor-like 17B (ARL17B), transcript variant 2


  "NM_001103154" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ARL17B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ARL17B
Synonyms ARL17; ARL17A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001103154, the custom clone sequence may differ by one or more nucleotides


ATGGGAAACATTTTTGAAAAGCTCTTTAAAAGTCTACTTGGGAAAAAAAAGATGCGGATTCTTATATTGA
GTTTGGATACAGCTGGAAAAACCACCATCTTGTATAAATTGAAGCTGGGGGAGACTGTGCCTGCCGTCCC
TACAGTAGGTTTCTGTGTGGAGACAGTAGAATATAAAAATAACACCTTCGCTGTCTGGGATGTTGGCAGC
CACTTCAAAATCAGACCTCTGTGGCAGCATTTTTTCCAGAACACAAAAGAGCTATCAGCTTCCCAGTTTG
CACAATTCATCAAGAAATTATGCGGGGTCACTGGCACAAATGATGAGGCATCTCCTGGAAGCTTAACTTC
TTATCCATCCCATCTCTTGGACAGATGA


Restriction Sites SgfI-MluI     
ACCN NM_001103154
ORF Size 378 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001103154.1, NP_001096624.1
RefSeq Size 488
RefSeq ORF 378
Locus ID 100506084

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.