IFT43 (NM_001102564) Human Untagged Clone
CAT#: SC316907
IFT43 (untagged)-Human chromosome 14 open reading frame 179 (C14orf179), transcript variant 2
"NM_001102564" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IFT43 |
Synonyms | C14orf179; CED3; RP81; SRTD18 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001102564, the custom clone sequence may differ by one or more nucleotides
ATGGAGGATTTGCTCGACTTGGACGAGGAGCTTCGCTACAGCTTGGCTACCTCCAGGGCCAAGATGGGTC GCCGAGCTCAACAGGAGTCAGCGCAGGCCGAGAATCACCTCAATGGCAAGAATTCCTCTTTGACTCTGAC TGGAGAGACTTCCTCTGCTAAATTACCTCGCTGCCGACAGGGAGGCTGGGCAGGTGATTCCGTGAAGGCT TCGAAGTTTAGGAGGAAGGCTTCTGAAGAAATAGAAGATTTCCGCCTCAGACCACAGAGCCTGAATGGAT CAGATTATGGAGGAGATATTCCTATCATTCCGGATCTGGAGGAAGTACAGGAAGAAGACTTTGTTTTGCA GGTGGCAGCCCCTCCCAGCATCCAGATAAAGCGGGTGATGACCTACCGTGACCTGGACAATGACCTCATG AAGTACTCAGCCATTCAGACACTGGATGGGGAGATCGACCTGAAACTCCTCACCAAAGTGCTCGCGCCGG AGCACGAAGTCCGGGAGGATGATGTCGGCTGGGACTGGGACCATCTGTTCACTGAGGTGTCCTCAGAGGT CCTCACTGAGTGGGACCCACTGCAGACGGAGAAGGAGGACCCTGCGGGGCAGGCCAGGCACACCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001102564 |
ORF Size | 627 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001102564.1, NP_001096034.1 |
RefSeq Size | 850 |
RefSeq ORF | 627 |
Locus ID | 112752 |
Gene Summary | This gene encodes a subunit of the intraflagellar transport complex A (IFT-A). IFT-A is a multiprotein complex that plays an important role in cilia assembly and maintenance by mediating retrograde ciliary transport. Mutations in this gene are a cause of cranioectodermal dysplasia-3 (CED3), also known as Sensenbrenner syndrome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (2) lacks an exon and contains two alternate exons in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223029 | IFT43 (Myc-DDK-tagged)-Human chromosome 14 open reading frame 179 (C14orf179), transcript variant 2 |
USD 420.00 |
|
RG223029 | IFT43 (GFP-tagged) - Human chromosome 14 open reading frame 179 (C14orf179), transcript variant 2 |
USD 460.00 |
|
RC223029L3 | Lenti ORF clone of Human chromosome 14 open reading frame 179 (C14orf179), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC223029L4 | Lenti ORF clone of Human chromosome 14 open reading frame 179 (C14orf179), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review