RGS4 (NM_001102445) Human Untagged Clone

CAT#: SC316920

RGS4 (untagged)-Human regulator of G-protein signaling 4 (RGS4), transcript variant 1


  "NM_001102445" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RGS4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RGS4
Synonyms RGP4; SCZD9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001102445, the custom clone sequence may differ by one or more nucleotides


ATGTATAATATGATGCTTCTAATCCAAAAGAGGAAAGGCATTGGGAGTCAGCTCCTAAGGGCTGGAGAGG
CAGAGGGAGACAGAGGAGCTGGTACTGCAGAGCGGTCGTCTGATTGGCTGGACGGTCGTAGCTGGGCTAT
AAAAGAGACCCCTACAGGCTTAGCAGGAAGACGCTCAGAGGATTCTGACAATATCTTTACCGGAGAAGAG
GCAAAGTACGCTCAAAGCCGAAGCCACAGCTCCTCCTGCCGCATTTCTTTCCTGCTTGCGAATTCCAAGC
TGTTAAATAAGATGTGCAAAGGGCTTGCAGGTCTGCCGGCTTCTTGCTTGAGGAGTGCAAAAGATATGAA
ACATCGGCTAGGTTTCCTGCTGCAAAAATCTGATTCCTGTGAACACAATTCTTCCCACAACAAGAAGGAC
AAAGTGGTTATTTGCCAGAGAGTGAGCCAAGAGGAAGTCAAGAAATGGGCTGAATCACTGGAAAACCTGA
TTAGTCATGAATGTGGGCTGGCAGCTTTCAAAGCTTTCTTGAAGTCTGAATATAGTGAGGAGAATATTGA
CTTCTGGATCAGCTGTGAAGAGTACAAGAAAATCAAATCACCATCTAAACTAAGTCCCAAGGCCAAAAAG
ATCTATAATGAATTCATCTCAGTCCAGGCAACCAAAGAGGTGAACCTGGATTCTTGCACCAGGGAAGAGA
CAAGCCGGAACATGCTAGAGCCTACAATAACCTGCTTTGATGAGGCCCAGAAGAAGATTTTCAACCTGAT
GGAGAAGGATTCCTACCGCCGCTTCCTCAAGTCTCGATTCTATCTTGATTTGGTCAACCCGTCCAGCTGT
GGGGCAGAAAAGCAGAAAGGAGCCAAGAGTTCAGCAGACTGTGCTTCCCTGGTCCCTCAGTGTGCCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001102445
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001102445.2, NP_001095915.1
RefSeq Size 3480 bp
RefSeq ORF 909 bp
Locus ID 5999
Cytogenetics 1q23.3
Protein Families Druggable Genome
Gene Summary 'Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 4 belongs to this family. All RGS proteins share a conserved 120-amino acid sequence termed the RGS domain. Regulator of G protein signaling 4 protein is 37% identical to RGS1 and 97% identical to rat Rgs4. This protein negatively regulate signaling upstream or at the level of the heterotrimeric G protein and is localized in the cytoplasm. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (1) encodes the longest isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.