HIGD1C (NM_001109619) Human Untagged Clone

CAT#: SC317013

HIGD1C (untagged)-Human HIG1 hypoxia inducible domain family, member 1C (HIGD1C)


  "NM_001109619" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "HIGD1C"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HIGD1C
Synonyms GM921
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001109619, the custom clone sequence may differ by one or more nucleotides


ATGTCTTCAGATAACCAGTGGTCAGCAGATGAGGATGAAGGCCAATTATCCCGACTAATCAGGAAATCTA
GAGACTCCCCCTTTGTCCCTATAGGTATAGCAGGCTTTGTGACTGTGGTGTCCTGTGGTCTTTACAAGCT
AAAGTACAGAAGAGATCAGAAAATGTCAATTCATCTTATTCACATGAGAGTTGCTGCCCAAGGATTTGTT
GTTGGAGCTGTGACTCTAGGTGTTCTCTATTCTATGTATAAGGATTACATTAGACCACGATTCTTCAGTG
AGTCCAAAAAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001109619
ORF Size 294 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001109619.1, NP_001103089.1
RefSeq Size 294
RefSeq ORF 294
Locus ID 613227

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.