FABP12 (NM_001105281) Human Untagged Clone

CAT#: SC317029

FABP12 (untagged)-Human fatty acid binding protein 12 (FABP12)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FABP12
• Synonyms: fatty acid binding protein 12; fatty acid binding protein ORF; intracellular fatty acid-binding protein FABP12; Probable fatty acid-binding protein ENSP00000353650
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001105281, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATTGACCAGCTCCAAGGAACATGGAAGTCCATTTCTTGTGAAAATTCCGAAGACTACATGAAGGAGC
  TGGGTATAGGAAGAGCCAGCAGGAAACTGGGCCGTTTGGCAAAACCCACTGTGACCATCAGTACAGATGG
  AGATGTCATCACAATAAAAACCAAAAGCATCTTTAAAAATAATGAGATCTCCTTTAAGCTGGGAGAAGAG
  TTTGAGGAAATCACGCCAGGTGGCCACAAAACAAAGAGTAAAGTAACCTTAGATAAGGAGTCCCTGATTC
  AAGTTCAGGACTGGGATGGCAAAGAAACCACCATAACGAGAAAGCTGGTGGATGGGAAAATGGTGGTGGA
  AAGTACTGTGAACAGTGTTATCTGTACACGAACATACGAGAAAGTATCATCAAACTCAGTCTCAAACTCT
  TAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001105281
• ORF Size: 423 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001105281.1, NP_001098751.1
• RefSeq Size: 423
• RefSeq ORF: 423
• Locus ID: 646486
• Gene Summary: May play a role in lipid transport. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the protein-coding transcript. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.