GJB6 (NM_001110219) Human Untagged Clone

CAT#: SC317049

GJB6 (untagged)-Human gap junction protein, beta 6, 30kDa (GJB6), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GJB6
• Synonyms: CX30; DFNA3; DFNA3B; DFNB1B; ECTD2; ED2; EDH; HED; HED2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001110219, the custom clone sequence may differ by one or more nucleotides
  ATGGATTGGGGGACGCTGCACACTTTCATCGGGGGTGTCAACAAACACTCCACCAGCATC
  GGGAAGGTGTGGATCACAGTCATCTTTATTTTCCGAGTCATGATCCTCGTGGTGGCTGCC
  CAGGAAGTGTGGGGTGACGAGCAAGAGGACTTCGTCTGCAACACACTGCAACCGGGATGC
  AAAAATGTGTGCTATGACCACTTTTTCCCGGTGTCCCACATCCGGCTGTGGGCCCTCCAG
  CTGATCTTCGTCTCCACCCCAGCGCTGCTGGTGGCCATGCATGTGGCCTACTACAGGCAC
  GAAACCACTCGCAAGTTCAGGCGAGGAGAGAAGAGGAATGATTTCAAAGACATAGAGGAC
  ATTAAAAAGCAGAAGGTTCGGATAGAGGGGTCGCTGTGGTGGACGTACACCAGCAGCATC
  TTTTTCCGAATCATCTTTGAAGCAGCCTTTATGTATGTGTTTTACTTCCTTTACAATGGG
  TACCACCTGCCCTGGGTGTTGAAATGTGGGATTGACCCCTGCCCCAACCTTGTTGACTGC
  TTTATTTCTAGGCCAACAGAGAAGACCGTGTTTACCATTTTTATGATTTCTGCGTCTGTG
  ATTTGCATGCTGCTTAACGTGGCAGAGTTGTGCTACCTGCTGCTGAAAGTGTGTTTTAGG
  AGATCAAAGAGAGCACAGACGCAAAAAAATCACCCCAATCATGCCCTAAAGGAGAGTAAG
  CAGAATGAAATGAATGAGCTGATTTCAGATAGTGGTCAAAATGCAATCACAGGTTTCCCA
  AGC
  
• Restriction Sites: Please inquire
• ACCN: NM_001110219
• ORF Size: 786 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001110219.1, NP_001103689.1
• RefSeq Size: 2100
• RefSeq ORF: 786
• Locus ID: 10804
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: Gap junctions allow the transport of ions and metabolites between the cytoplasm of adjacent cells. They are formed by two hemichannels, made up of six connexin proteins assembled in groups. Each connexin protein has four transmembrane segments, two extracellular loops, a cytoplasmic loop formed between the two inner transmembrane segments, and the N- and C-terminus both being in the cytoplasm. The specificity of the gap junction is determined by which connexin proteins comprise the hemichannel. In the past, connexin protein names were based on their molecular weight, however the new nomenclature uses sequential numbers based on which form (alpha or beta) of the gap junction is present. This gene encodes one of the connexin proteins. Mutations in this gene have been found in some forms of deafness and in some families with hidrotic ectodermal dysplasia. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1) represents the longest transcript. All variants encode the same protein.