NRXN3 (NM_001105250) Human Untagged Clone
CAT#: SC317095
NRXN3 (untagged)-Human neurexin 3 (NRXN3), transcript variant 3
"NM_001105250" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NRXN3 |
Synonyms | C14orf60 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001105250, the custom clone sequence may differ by one or more nucleotides
ATGCACCTGAGAATCCACGCGAGACGGAGCCCTCCTCGCCGGCCGGCCTGGACGCTTGGGATCTGGTTCC TGTTCTGGGGATGTATCGTCAGCTCTGTATGGAGTTCTTCTAATGTAGCTTCCTCCTCCTCCACCTCTTC CTCGCCGGGGTCTCACTCTCAGCACGAGCACCATTTCCATGGCAGCAAGCATCACTCAGTGCCTATTTCT ATCTATCGTTCCCCTGTTTCCCTTCGAGGAGGACACGCTGGCGCTACGTACATCTTTGGGAAAAGTGGTG GGCTTATCCTCTACACCTGGCCAGCCAATGACAGGCCCAGCACGCGGTCTGACCGCCTTGCCGTGGGCTT CAGCACCACTGTGAAGGATGGCATCTTGGTCCGCATCGACAGTGCTCCAGGACTTGGTGACTTCCTCCAG CTTCACATAGAACAGGGGAAAATTGGAGTTGTCTTCAACATTGGCACAGTTGACATCTCCATCAAAGAGG AGAGAACCCCTGTAAATGACGGCAAATACCATGTGGTACGCTTCACCAGGAACGGCGGCAACGCCACCCT GCAGGTGGACAACTGGCCAGTGAATGAACATTATCCTACAGGCAACACTGATAATGAACGCTTCCAAATG GTAAAACAGAAAATCCCCTTCAAATATAATCGGCCTGTAGAGGAGTGGCTGCAGGAAAAAGGCCGGCAGT TAACCATCTTCAACACTCAGGCGCAAATAGCCATTGGTGGAAAGGACAAAGGACGCCTCTTCCAAGGCCA ACTCTCTGGGCTCTATTATGATGGTTTGAAAGTACTGAACATGGCGGCTGAGAACAACCCCAATATTAAA ATCAATGGAAGTGTTCGGCTGGTTGGAGAAGTCCCATCAATTTTGGGAACAACACAGACGACCTCCATGC CACCAGAAATGTCTACTACTGTCATGGAAACCACTACTACAATGGCGACTACCACAACCCGTAAGAATCG CTCTACAGCCAGCATTCAGCCAACATCAGATGATCTTGTTTCATCTGCTGAATGTTCAAGTGATGATGAA GACTTTGTTGAATGTGAGCCGAGTACAGCAAACCCCACGGAGCCGGGAATCAGACGGGTTCCGGGGGCCT CAGAGGTGATCCGGGAGTCGAGCAGCACAACAGGGATGGTCGTCGGCATTGTGGCTGCTGCCGCCCTCTG CATCTTGATCCTCCTGTACGCCATGTACAAGTACAGGAACAGGGACGAGGGGTCCTATCAAGTGGACGAG ACGCGGAACTACATCAGCAACTCCGCCCAGAGCAACGGCACGCTCATGAAGGAGAAGCAGCAGAGCTCGA AGAGCGGCCACAAGAAACAGAAAAACAAGGACAGGGAGTATTACGTGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001105250 |
ORF Size | 1380 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001105250.2, NP_001098720.1 |
RefSeq Size | 8659 |
RefSeq ORF | 1380 |
Locus ID | 9369 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Cell adhesion molecules (CAMs) |
Gene Summary | This gene encodes a member of a family of proteins that function in the nervous system as receptors and cell adhesion molecules. Extensive alternative splicing and the use of alternative promoters results in multiple transcript variants and protein isoforms for this gene, but the full-length nature of many of these variants has not been determined. Transcripts that initiate from an upstream promoter encode alpha isoforms, which contain epidermal growth factor-like (EGF-like) sequences and laminin G domains. Transcripts initiating from the downstream promoter encode beta isoforms, which lack EGF-like sequences. Genetic variation at this locus has been associated with a range of behavioral phenotypes, including alcohol dependence and autism spectrum disorder. [provided by RefSeq, Dec 2012] Transcript Variant: This variant (3) differs in the 5' UTR and contains multiple differences in the coding region, including the lack of multiple 5' exons, compared to variant 1. It initiates translation at an alternate start codon. The encoded isoform (3) is shorter and has a distinct N-terminus, compared to isoform 1. This variant encodes a beta isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225771 | NRXN3 (Myc-DDK-tagged)-Human neurexin 3 (NRXN3), transcript variant 3 |
USD 430.00 |
|
RG225771 | NRXN3 (GFP-tagged) - Human neurexin 3 (NRXN3), transcript variant 3 |
USD 470.00 |
|
RC225771L1 | Lenti-ORF clone of NRXN3 (Myc-DDK-tagged)-Human neurexin 3 (NRXN3), transcript variant 3 |
USD 780.00 |
|
RC225771L2 | Lenti-ORF clone of NRXN3 (mGFP-tagged)-Human neurexin 3 (NRXN3), transcript variant 3 |
USD 630.00 |
|
RC225771L3 | Lenti-ORF clone of NRXN3 (Myc-DDK-tagged)-Human neurexin 3 (NRXN3), transcript variant 3 |
USD 630.00 |
|
RC225771L4 | Lenti-ORF clone of NRXN3 (mGFP-tagged)-Human neurexin 3 (NRXN3), transcript variant 3 |
USD 630.00 |
{0} Product Review(s)
Be the first one to submit a review