SPTSSA (NM_138288) Human Untagged Clone
CAT#: SC317216
SPTSSA (untagged)-Human chromosome 14 open reading frame 147 (C14orf147)
"NM_138288" in other vectors (5)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | SPTSSA |
| Synonyms | C14orf147; SSSPTA |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_138288, the custom clone sequence may differ by one or more nucleotides
ATGGCGGGGATGGCGCTGGCGCGGGCCTGGAAGCAGATGTCCTGGTTCTACTACCAGTACCTGCTGGTCA CGGCGCTCTACATGCTGGAGCCCTGGGAGCGGACGGTGTTCAATTCCATGCTGGTTTCCATTGTGGGGAT GGCACTATACACAGGATACGTCTTCATGCCCCAGCACATCATGGCGATATTGCACTACTTTGAAATCGTA CAATGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_138288 |
| ORF Size | 216 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Reference Data | |
| RefSeq | NM_138288.3, NP_612145.2 |
| RefSeq Size | 2538 |
| RefSeq ORF | 216 |
| Locus ID | 171546 |
| Protein Families | Transmembrane |
| Gene Summary | Serine palmitoyltransferase (SPT; EC 2.3.1.50) catalyzes the first committed and rate-limiting step in sphingolipid biosynthesis. SSSPTA is a small SPT subunit that stimulates SPT activity and confers acyl-CoA preference to the SPT catalytic heterodimer of SPTLC1 (MIM 605712) and either SPTLC2 (MIM 605713) or SPTLC3 (MIM 611120) (Han et al., 2009 [PubMed 19416851]). [supplied by OMIM, Nov 2010] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| SC120477 | SPTSSA (untagged)-Human chromosome 14 open reading frame 147 (C14orf147) |
USD 310.00 |
|
| RC209747 | SPTSSA (Myc-DDK-tagged)-Human chromosome 14 open reading frame 147 (C14orf147) |
USD 150.00 |
|
| RG209747 | SPTSSA (GFP-tagged) - Human chromosome 14 open reading frame 147 (C14orf147) |
USD 460.00 |
|
| RC209747L3 | Lenti ORF clone of Human chromosome 14 open reading frame 147 (C14orf147), Myc-DDK-tagged |
USD 768.00 |
|
| RC209747L4 | Lenti ORF clone of Human chromosome 14 open reading frame 147 (C14orf147), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China