SPTSSA (NM_138288) Human Untagged Clone

CAT#: SC317216

SPTSSA (untagged)-Human chromosome 14 open reading frame 147 (C14orf147)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SPTSSA
• Synonyms: C14orf147; SSSPTA
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_138288, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGGGATGGCGCTGGCGCGGGCCTGGAAGCAGATGTCCTGGTTCTACTACCAGTACCTGCTGGTCA
  CGGCGCTCTACATGCTGGAGCCCTGGGAGCGGACGGTGTTCAATTCCATGCTGGTTTCCATTGTGGGGAT
  GGCACTATACACAGGATACGTCTTCATGCCCCAGCACATCATGGCGATATTGCACTACTTTGAAATCGTA
  CAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_138288
• ORF Size: 216 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_138288.3, NP_612145.2
• RefSeq Size: 2538
• RefSeq ORF: 216
• Locus ID: 171546
• Protein Families: Transmembrane
• Gene Summary: Serine palmitoyltransferase (SPT; EC 2.3.1.50) catalyzes the first committed and rate-limiting step in sphingolipid biosynthesis. SSSPTA is a small SPT subunit that stimulates SPT activity and confers acyl-CoA preference to the SPT catalytic heterodimer of SPTLC1 (MIM 605712) and either SPTLC2 (MIM 605713) or SPTLC3 (MIM 611120) (Han et al., 2009 [PubMed 19416851]). [supplied by OMIM, Nov 2010]