TAC4 (NM_170685) Human Untagged Clone

CAT#: SC317228

TAC4 (untagged)-Human tachykinin 4 (hemokinin) (TAC4), transcript variant alpha

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TAC4
• Synonyms: EK; HK-1; HK1; PPT-C
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_170685, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGCCTTGCCTCGCCCTGCTTCTCCTGATGGAGCTGTCCGTGTGCACTGTGGCAGGTGATGGTGGAG
  AGGAACAGACACTCAGCACTGAAGCAGAGACCTGGGTAATTGTGGCCTTGGAGGAAGGCGCTGGCCCCAG
  CATTCAGCTCCAGCTGCAGGAGGTGAAGACGGGCAAGGCAAGCCAGTTCTTTGGGCTGATGGGGAAGCGA
  GTGGGAGGAAGACCTCTGATCCAGCCAAGGAGAAAAAAAGCATATCAGCTGGAACACACGTTCCAGGGCC
  TCCTGGGCAAGAGAAGCCTGTTCACAGAAGGCAGAGAGGATGAGGCCCAAGGTTCAGAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_170685
• ORF Size: 342 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_170685.2, NP_733786.2
• RefSeq Size: 675
• RefSeq ORF: 342
• Locus ID: 255061
• Gene Summary: This gene is a member of the tachykinin family of neurotransmitter-encoding genes. Tachykinin proteins are cleaved into small, secreted peptides that activate members of a family of receptor proteins. The products of this gene preferentially activate tachykinin receptor 1, and are thought to regulate peripheral endocrine and paracrine functions including blood pressure, the immune system, and endocrine gland secretion. The products of this gene lack a dibasic cleavage site found in other tachykinin proteins. Consequently, the nature of the cleavage products generated in vivo remains to be determined. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (alpha) represents the longest transcript and encodes the longest isoform (alpha).