DPM3 (NM_018973) Human Untagged Clone

CAT#: SC317229

DPM3 (untagged)-Human dolichyl-phosphate mannosyltransferase polypeptide 3 (DPM3), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DPM3
• Synonyms: CDG1O
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_018973, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTCTCCGTGGGCGGGCTTCGGTTGAGTTTGGTCCGCTTTTCCTTTCTGCTCCTCAGGGGAGCATTGC
  TTCCTTCTCTCGCAGTGACCATGACGAAATTAGCGCAGTGGCTTTGGGGACTAGCGATCCTGGGCTCCAC
  CTGGGTGGCCCTGACCACGGGAGCCTTGGGCCTGGAGCTGCCCTTGTCCTGCCAGGAAGTCCTGTGGCCA
  CTGCCCGCCTACTTGCTGGTGTCCGCCGGCTGCTATGCCCTGGGCACTGTGGGCTATCGTGTGGCCACTT
  TTCATGACTGCGAGGACGCCGCACGCGAGCTGCAGAGCCAGATACAGGAGGCCCGAGCCGACTTAGCCCG
  CAGGGGGCTGCGCTTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_018973
• ORF Size: 369 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_018973.3, NP_061846.2
• RefSeq Size: 532
• RefSeq ORF: 369
• Locus ID: 54344
• Protein Families: Transmembrane
• Protein Pathways: Metabolic pathways, N-Glycan biosynthesis
• Gene Summary: Dolichol-phosphate mannose (Dol-P-Man) serves as a donor of mannosyl residues on the lumenal side of the endoplasmic reticulum (ER). Lack of Dol-P-Man results in defective surface expression of GPI-anchored proteins. Dol-P-Man is synthesized from GDP-mannose and dolichol-phosphate on the cytosolic side of the ER by the enzyme dolichyl-phosphate mannosyltransferase. The protein encoded by this gene is a subunit of dolichyl-phosphate mannosyltransferase and acts as a stabilizer subunit of the dolichyl-phosphate mannosyltransferase complex. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1) encodes the longer isoform (1).