ZNF593 (NM_015871) Human Untagged Clone
CAT#: SC317235
ZNF593 (untagged)-Human zinc finger protein 593 (ZNF593)
"NM_015871" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ZNF593 |
Synonyms | ZT86 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_015871, the custom clone sequence may differ by one or more nucleotides
ATGGGTCGCTCCCGCCGGACAGGCGCGCACCGAGCGCACTCTCTAGCCCGGCAGATGAAGGCGAAGCGGC GGCGGCCGGACTTGGATGAGATTCACCGCGAGCTGCGGCCTCAGGGATCCGCACGACCCCAGCCCGACCC AAACGCCGAGTTCGACCCCGACCTGCCAGGGGGCGGTCTGCACCGCTGTCTGGCCTGCGCGAGGTACTTC ATCGATTCCACCAACCTGAAGACCCACTTCCGATCCAAAGACCACAAGAAAAGGCTGAAGCAGCTGAGCG TCGAGCCCTACAGTCAGGAAGAGGCGGAGAGGGCAGCGGGTATGGGATCCTATGTGCCCCCCAGGCGGCT GGCAGTGCCCACGGAAGTGTCCACTGAGGTCCCTGAGATGGATACCTCTACCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_015871 |
ORF Size | 405 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_015871.4, NP_056955.2 |
RefSeq Size | 653 |
RefSeq ORF | 405 |
Locus ID | 51042 |
Protein Families | Stem cell - Pluripotency, Transcription Factors |
Gene Summary | Negatively modulates the DNA binding activity of Oct-2 and therefore its transcriptional regulatory activity. Could act either by binding to DNA octamer or by interacting with Oct-2. May also be a modulator of other octamer-binding proteins. [UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC108174 | ZNF593 (untagged)-Human zinc finger protein 593 (ZNF593) |
USD 310.00 |
|
RC201028 | ZNF593 (Myc-DDK-tagged)-Human zinc finger protein 593 (ZNF593) |
USD 98.00 |
|
RG201028 | ZNF593 (GFP-tagged) - Human zinc finger protein 593 (ZNF593) |
USD 460.00 |
|
RC201028L3 | Lenti ORF clone of Human zinc finger protein 593 (ZNF593), Myc-DDK-tagged |
USD 620.00 |
|
RC201028L4 | Lenti ORF clone of Human zinc finger protein 593 (ZNF593), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review