DSCR1L1 (RCAN2) (NM_005822) Human Untagged Clone

CAT#: SC317291

RCAN2 (untagged)-Human regulator of calcineurin 2 (RCAN2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RCAN2
• Synonyms: CSP2; DSCR1L1; MCIP2; RCN2; ZAKI-4; ZAKI4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_005822, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCAGCCCCTAGCATGGACTGTGATGTTTCCACTCTGGTTGCCTGTGTGGTGGATGTCGAGGTCTTTA
  CCAATCAGGAGGTTAAGGAAAAATTTGAGGGACTGTTTCGGACTTATGATGACTGTGTGACGTTCCAGCT
  ATTTAAGAGTTTCAGACGTGTCCGTATAAACTTCAGCAATCCTAAATCTGCAGCCCGAGCTAGGATAGAG
  CTTCATGAAACCCAATTCAGAGGGAAAAAATTAAAGCTCTACTTTGCACAGGTTCAGACTCCAGAGACAG
  ATGGAGACAAACTGCACTTGGCTCCACCCCAGCCTGCCAAACAGTTTCTCATCTCGCCCCCTTCCTCCCC
  ACCTGTTGGCTGGCAGCCCATCAACGATGCCACGCCAGTCCTCAACTATGACCTCCTCTATGCTGTGGCC
  AAACTAGGACCAGGAGAGAAGTATGAGCTCCATGCAGGGACTGAGTCCACCCCAAGTGTCGTCGTGCACG
  TGTGCGACAGTGACATAGAGGAAGAAGAGGACCCAAAGACTTCCCCAAAGCCAAAAATCATCCAAACTCG
  GCGTCCTGGCCTGCCACCCTCCGTGTCCAACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_005822
• ORF Size: 594 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_005822.3, NP_005813.2
• RefSeq Size: 3438
• RefSeq ORF: 594
• Locus ID: 10231
• Domains: Calcipressin
• Gene Summary: This gene encodes a member of the regulator of calcineurin (RCAN) protein family. These proteins play a role in many physiological processes by binding to the catalytic domain of calcineurin A, inhibiting calcineurin-mediated nuclear translocation of the transcription factor NFATC1. Expression of this gene in skin fibroblasts is upregulated by thyroid hormone, and the encoded protein may also play a role in endothelial cell function and angiogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
  Transcript Variant: This variant (1, also known as alpha) represents the longest transcript and encodes the shorter isoform (1, also known as alpha).