VTI1A (NM_145206) Human Untagged Clone

CAT#: SC317321

VTI1A (untagged)-Human vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (VTI1A)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: VTI1A
• Synonyms: MMDS3; MVti1; Vti1-rp2; VTI1RP2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_145206, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCGTCCGACTTCGAAGGTTACGAGCAGGACTTCGCGGTGCTCACTGCAGAGATCACCAGCAAGATTG
  CGAGGGTCCCACGACTCCCGCCTGATGAAAAGAAACAGATGGTTGCAAATGTGGAGAAACAGCTTGAAGA
  AGCGAAAGAACTGCTTGAACAGATGGATTTGGAAGTCCGAGAGATACCACCCCAAAGTCGAGGGATGTAC
  AGCAACAGAATGAGAAGCTACAAACAAGAAATGGGAAAACTCGAAACAGATTTTAAAAGGTCACGGATCG
  CCTACAGTGACGAAGTACGGAATGAGCTCCTGGGGGATGATGGGAATTCCTCAGAGAACCAGAGGGCACA
  TCTGCTCGATAACACAGAGAGGCTGGAAAGGTCATCTCGGAGACTAGAGGCTGGATACCAAATAGCAGTG
  GAAACCGAGCAAATTGGTCAGGAGATGTTGGAAAACCTTAGTCATGACAGAGAAAAGATACAGCGAGCAC
  GTGAAAGACTTCGGGAAACAGATGCTAATTTGGGAAAAAGCTCCAGGATTCTGACAGGGATGTTGCGAAG
  AATCATCCAGAACCGCATCCTGCTCGTCATCCTAGGGATCATCGTGGTCATCACCATCCTGATGGCGATC
  ACTTTTTCTGTCAGAAGACACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_145206
• ORF Size: 654 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_145206.3, NP_660207.2
• RefSeq Size: 4417
• RefSeq ORF: 654
• Locus ID: 143187
• Domains: V-SNARE
• Protein Families: Transmembrane
• Protein Pathways: SNARE interactions in vesicular transport
• Gene Summary: The protein encoded by this gene is a member of the family of soluble N-ethylmaleimide-sensitive fusion protein-attachment protein receptors (SNAREs) that function in intracellular trafficking. This family member is involved in vesicular transport between endosomes and the trans-Golgi network. It is a vesicle-associated SNARE (v-SNARE) that interacts with target membrane SNAREs (t-SNAREs). Polymorphisms in this gene have been associated with binocular function, and also with susceptibility to colorectal and lung cancers. A recurrent rearrangement has been found between this gene and the transcription factor 7-like 2 (TCF7L2) gene in colorectal cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.