SPCS2 (NM_014752) Human Untagged Clone

CAT#: SC317328

SPCS2 (untagged)-Human signal peptidase complex subunit 2 homolog (S. cerevisiae) (SPCS2)


  "NM_014752" in other vectors (5)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SPCS2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SPCS2
Synonyms KIAA0102; MGC117366
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_014752, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCGGCAGCTGTACAGGGCGGGAGAAGCGGTGGTAGCGGAGGCTGTAGTGGGGCTGGTGGTGCTT
CCAACTGCGGGACAGGAAGTGGCCGTAGCGGCTTGTTGGATAAGTGGAAGATAGATGATAAGCCTGTAAA
AATTGACAAGTGGGATGGATCAGCTGTGAAAAACTCTTTGGATGATTCTGCCAAAAAGGTACTTCTGGAA
AAATACAAATATGTGGAGAATTTTGGTCTAATTGATGGTCGCCTCACCATCTGTACAATCTCCTGTTTCT
TTGCCATAGTGGCTTTGATTTGGGATTATATGCACCCCTTTCCAGAGTCCAAACCCGTTTTGGCTTTGTG
TGTCATATCCTATTTTGTGATGATGGGGATTCTGACCATTTATACCTCATATAAGGAGAAGAGCATCTTT
CTCGTGGCCCACAGGAAAGATCCTACAGGAATGGATCCTGATGATATTTGGCAGCTGTCCTCCAGTCTTA
AAAGGTTTGATGACAAATACACCTTGAAGCTGACCTTCATCAGTGGGAGAACAAAGCAGCAGCGGGAAGC
CGAGTTCACAAAGTCCATTGCTAAGTTTTTTGACCACAGTGGGACACTGGTCATGGATGCATATGAGCCT
GAAATATCCAGGCTCCATGACAGTCTTGCCATAGAAAGAAAAATAAAGTAG


Restriction Sites SgfI-MluI     
ACCN NM_014752
ORF Size 681 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_014752.2, NP_055567.2
RefSeq Size 2731
RefSeq ORF 681
Locus ID 9789
Protein Families Protease, Transmembrane
Gene Summary Component of the microsomal signal peptidase complex which removes signal peptides from nascent proteins as they are translocated into the lumen of the endoplasmic reticulum. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.