DHRS4L2 (NM_198083) Human Untagged Clone
CAT#: SC317337
DHRS4L2 (untagged)-Human dehydrogenase/reductase (SDR family) member 4 like 2 (DHRS4L2), transcript variant 1
"NM_198083" in other vectors (7)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DHRS4L2 |
Synonyms | SDR25C3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_198083, the custom clone sequence may differ by one or more nucleotides
ATGCAGATGGCCAGGCTGCTAGGCCTCTGTGCCTGGGCACGGAAGTCGGTGCGGATGGCCAGCTCCAGGA TGACCCGCCGGGACCCGCTCACAAATAAGGTGGCCCTGGTAACGGCCTCCACCGACGGGATCGGCTTCGC CATCGCCCGGCGTTTGGCCCAGGACAGGGCCCACGTGGTCGTCAGCAGCCGGAAGCAGCAGAATGTGGAC CAGGCGGTGGCCACGCTGCAGGGGGAGGGGCTGAGCGTGACGGGCACTGTGTGCCATGTGGGGAAGGCGG AGGACCGGGAGCGGCTGGTGGCCATGGCTGTGAAGCTTCATGGAGGTATCGATATCCTAGTCTCCAATGC TGCTGTCAACCCTTTCTTTGGAAGCCTAATGGATGTCACCGAGGAGGTGTGGGACAAGACTCTGGACATT AATGTGAAGGCCCCAGCCCTGATGACAAAGGCAGTGGTGCCAGAAATGGAGAAACGAGGAGGCGGCTCAG TGGTGATCGTGTCTTCCATAGCAGCCTTCAGTCCATCTCCTGGCTTCAGTCCTTACAATGTCAGTAAAAC AGCCTTGCTGGGCCTCAACAATACCCTGGCCATAGAGCTGGCCCCAAGGAACATTAGGGTGAACTGCCTG CACCTGGACTTATCAAGACTAGCTTCAGCAGGATGCTCTGGATGGACAAGGAAAAAGAGGAAAGCATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_198083 |
ORF Size | 699 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_198083.3, NP_932349.2 |
RefSeq Size | 1384 |
RefSeq ORF | 699 |
Locus ID | 317749 |
Protein Families | Druggable Genome |
Protein Pathways | Metabolic pathways, Retinol metabolism |
Gene Summary | This gene encodes a member of the short chain dehydrogenase reductase family. The encoded protein may be an NADPH dependent retinol oxidoreductase. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010] Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: This CCDS representation uses the 5'-most in-frame start codon, which is conserved in other species. An alternative downstream start codon, which is specific to human and has a slightly stronger Kozak signal, also exists. It is possible that leaky scanning by ribosomes would allow the downstream start codon to be used, at least some of the time. The use of the downstream start codon would result in a protein that is 2 aa shorter at the N-terminus. There is no experimental evidence showing which start codon is preferentially used in vivo. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC126075 | DHRS4L2 (untagged)-Human dehydrogenase/reductase (SDR family) member 4 like 2 (DHRS4L2), transcript variant 1 |
USD 420.00 |
|
RC215019 | DHRS4L2 (Myc-DDK-tagged)-Human dehydrogenase/reductase (SDR family) member 4 like 2 (DHRS4L2), transcript variant 1 |
USD 98.00 |
|
RG215019 | DHRS4L2 (GFP-tagged) - Human dehydrogenase/reductase (SDR family) member 4 like 2 (DHRS4L2), transcript variant 1 |
USD 460.00 |
|
RC215019L1 | Lenti ORF clone of Human dehydrogenase/reductase (SDR family) member 4 like 2 (DHRS4L2), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC215019L2 | Lenti ORF clone of Human dehydrogenase/reductase (SDR family) member 4 like 2 (DHRS4L2), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC215019L3 | Lenti ORF clone of Human dehydrogenase/reductase (SDR family) member 4 like 2 (DHRS4L2), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC215019L4 | Lenti ORF clone of Human dehydrogenase/reductase (SDR family) member 4 like 2 (DHRS4L2), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review