FAM177A1 (NM_173607) Human Untagged Clone

CAT#: SC317340

FAM177A1 (untagged)-Human family with sequence similarity 177, member A1 (FAM177A1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FAM177A1
• Synonyms: C14orf24
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_173607, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAAGTGGGCTTACCGGCCATTACCCTCTTTCTCACCAGCGCCAGCAGCCCTGTGGTGGCGACGACGA
  TGGACCAGGAGCCAGTGGGCGGTGTGGAACGAGGAGAAGCCGTCGCAGCCTCGGGAGCTGCGGCCGCCGC
  GGCATTCGGGGAATCTGCAGGGCAGATGAGTAACGAAAGAGGCTTTGAAAATGTAGAACTGGGAGTCATA
  GGAAAAAAGAAGAAAGTCCCAAGGAGAGTCATCCACTTTGTTAGTGGTGAAACAATGGAAGAATATAGCA
  CAGATGAAGACGAAGTTGATGGCCTGGAGAAGAAAGATGTTTTGCCTACTGTTGATCCGACAAAACTTAC
  CTGGGGTCCCTACTTATGGTTTTACATGCTTCGGGCTGCTACATCAACTCTCTCAGTGTGTGACTTCCTT
  GGAGAGAAGATTGCATCTGTTTTGGGTATCAGCACCCCAAAGTACCAATATGCCATTGATGAATATTATC
  GGATGAAGAAGGAGGAAGAAGAAGAAGAAGAAGAAAACAGGATGTCTGAAGAAGCAGAAAAACAATATCA
  ACAGAATAAATTGCAGACTGATTCCATTGTTCAGACAGATCAACCAGAGACAGTGATATCCAGCTCATTT
  GTGAATGTCAATTTTGAAATGGAGGGAGACAGTGAAGTAATTATGGAAAGCAAGCAAAATCCAGTCTCTG
  TCCCACCATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_173607
• ORF Size: 711 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_173607.3, NP_775878.2
• RefSeq Size: 2946
• RefSeq ORF: 711
• Locus ID: 283635
• Gene Summary: This gene encodes a member of a conserved protein family. Alternative splicing results in multiple transcript variants. This gene is thought to be associated with susceptibility to juvenile idiopathic arthritis. [provided by RefSeq, Apr 2017]
  Transcript Variant: This variant (1) encodes the longer protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.