FAM177A1 (NM_173607) Human Untagged Clone
CAT#: SC317340
FAM177A1 (untagged)-Human family with sequence similarity 177, member A1 (FAM177A1), transcript variant 1
"NM_173607" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FAM177A1 |
Synonyms | C14orf24 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_173607, the custom clone sequence may differ by one or more nucleotides
ATGGAAGTGGGCTTACCGGCCATTACCCTCTTTCTCACCAGCGCCAGCAGCCCTGTGGTGGCGACGACGA TGGACCAGGAGCCAGTGGGCGGTGTGGAACGAGGAGAAGCCGTCGCAGCCTCGGGAGCTGCGGCCGCCGC GGCATTCGGGGAATCTGCAGGGCAGATGAGTAACGAAAGAGGCTTTGAAAATGTAGAACTGGGAGTCATA GGAAAAAAGAAGAAAGTCCCAAGGAGAGTCATCCACTTTGTTAGTGGTGAAACAATGGAAGAATATAGCA CAGATGAAGACGAAGTTGATGGCCTGGAGAAGAAAGATGTTTTGCCTACTGTTGATCCGACAAAACTTAC CTGGGGTCCCTACTTATGGTTTTACATGCTTCGGGCTGCTACATCAACTCTCTCAGTGTGTGACTTCCTT GGAGAGAAGATTGCATCTGTTTTGGGTATCAGCACCCCAAAGTACCAATATGCCATTGATGAATATTATC GGATGAAGAAGGAGGAAGAAGAAGAAGAAGAAGAAAACAGGATGTCTGAAGAAGCAGAAAAACAATATCA ACAGAATAAATTGCAGACTGATTCCATTGTTCAGACAGATCAACCAGAGACAGTGATATCCAGCTCATTT GTGAATGTCAATTTTGAAATGGAGGGAGACAGTGAAGTAATTATGGAAAGCAAGCAAAATCCAGTCTCTG TCCCACCATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_173607 |
ORF Size | 711 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_173607.3, NP_775878.2 |
RefSeq Size | 2946 |
RefSeq ORF | 711 |
Locus ID | 283635 |
Gene Summary | This gene encodes a member of a conserved protein family. Alternative splicing results in multiple transcript variants. This gene is thought to be associated with susceptibility to juvenile idiopathic arthritis. [provided by RefSeq, Apr 2017] Transcript Variant: This variant (1) encodes the longer protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC127596 | FAM177A1 (untagged)-Human family with sequence similarity 177, member A1 (FAM177A1), transcript variant 1 |
USD 420.00 |
|
RC216009 | FAM177A1 (Myc-DDK-tagged)-Human family with sequence similarity 177, member A1 (FAM177A1), transcript variant 1 |
USD 98.00 |
|
RG216009 | FAM177A1 (GFP-tagged) - Human family with sequence similarity 177, member A1 (FAM177A1), transcript variant 1 |
USD 460.00 |
|
RC216009L1 | Lenti ORF clone of Human family with sequence similarity 177, member A1 (FAM177A1), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC216009L2 | Lenti ORF clone of Human family with sequence similarity 177, member A1 (FAM177A1), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC216009L3 | Lenti ORF clone of Human family with sequence similarity 177, member A1 (FAM177A1), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC216009L4 | Lenti ORF clone of Human family with sequence similarity 177, member A1 (FAM177A1), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review