BARX1 (NM_021570) Human Untagged Clone

CAT#: SC317363

BARX1 (untagged)-Human BARX homeobox 1 (BARX1)


  "NM_021570" in other vectors (7)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "BARX1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BARX1
Synonyms BarH-like homeobox 1; BARX homeobox 1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_021570, the custom clone sequence may differ by one or more nucleotides
ATGCAGCGGCCGGGGGAGCCGGGCGCCGCGCGCTTCGGCCCGCCCGAGGGCTGCGCGGAC
CACCGGCCGCACCGCTATCGCAGCTTCATGATTGAGGAGATCCTCACGGAGCCACCCGGG
CCCAAGGGCGCCGCGCCCGCAGCCGCCGCTGCCGCGGCGGGCGAGCTGCTGAAGTTCGGC
GTGCAGGCGCTGCTGGCGGCGCGGCCCTTCCACAGCCACCTGGCCGTGCTGAAGGCCGAG
CAGGCGGCGGTGTTCAAGTTCCCACTGGCGCCGCTGGGCTGTTCAGGGCTGAGCTCTGCG
TTGCTGGCGGCAGGGCCCGGGCTGCCCGGCGCCGCGGGTGCGCCACACCTGCCGCTCGAG
TTGCAGCTCCGCGGGAAGCTGGAGGCGGCAGGCCCTGGGGAGCCAGGCACCAAAGCCAAG
AAGGGGCGTCGGAGCCGCACTGTGTTCACCGAGCTGCAGCTGATGGGCCTGGAGAAACGC
TTCGAGAAGCAGAAGTACCTTTCCACGCCGGACAGAATAGATCTTGCTGAGTCCCTGGGC
CTGAGCCAGTTGCAGGTGAAGACGTGGTACCAGAATCGGAGGATGAAGTGGAAGAAAATA
GTGCTGCAGGGCGGCGGCCTGGAGTCTCCCACCAAGCCCAAGGGGCGGCCCAAGAAGAAC
TCAATTCCAACGAGCGAGCAGCTTACTGAGCAGGAGCGCGCCAAGGATGCAGAGAAACCG
GCGGAGGTGCCGGGCGAGCCCAGCGACAGGAGCCGCGAGGAC
Restriction Sites Please inquire     
ACCN NM_021570
ORF Size 765 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_021570.3, NP_067545.3
RefSeq Size 1498
RefSeq ORF 765
Locus ID 56033
Protein Families Transcription Factors
Gene Summary This gene encodes a member of the Bar subclass of homeobox transcription factors. Studies of the mouse and chick homolog suggest the encoded protein may play a role in developing teeth and craniofacial mesenchyme of neural crest origin. The protein may also be associated with differentiation of stomach epithelia. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.