CHMP4A (NM_014169) Human Untagged Clone

CAT#: SC317381

CHMP4A (untagged)-Human chromatin modifying protein 4A (CHMP4A)


  "NM_014169" in other vectors (7)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CHMP4A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CHMP4A
Synonyms C14orf123; CHMP4; CHMP4B; HSPC134; SHAX2; SNF7; SNF7-1; VPS32-1; VPS32A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_014169, the custom clone sequence may differ by one or more nucleotides


ATGTCGCGGCGGCGCCCTGAGGACGGATTGGGCAAGGCTGGTCCCTGTGTGATGAGACATCACCCTCCCA
GGAGCAAGGCGGAAGTCTGGAGGACGCTGAGGGGCGGAGGCGGGAGAGGCGAGCTCGCGATGAGTGGTCT
CGGCAGGCTCTTCGGGAAGGGGAAGAAGGAGAAAGGGCCAACCCCTGAAGAAGCAATACAGAAACTGAAG
GAGACAGAGAAGATACTGATCAAGAAACAGGAATTTTTGGAGCAGAAGATTCAACAGGAGCTACAAACAG
CCAAGAAGTATGGGACCAAGAATAAGAGAGCTGCCCTACAGGCTTTGCGGAGGAAGAAAAGATTCGAACA
GCAGCTGGCACAAACTGACGGGACATTATCCACCCTGGAGTTTCAGCGTGAGGCCATTGAGAATGCCACT
ACCAATGCAGAAGTCCTTCGTACCATGGAGCTTGCTGCCCAAAGCATGAAGAAGGCCTACCAGGACATGG
ACATTGACAAGGTAGATGAACTGATGACTGACATCACGGAACAACAGGAGGTGGCCCAGCAGATCTCAGA
TGCCATTTCTCGGCCTATGGGCTTTGGAGATGATGTGGATGAGGATGAACTGCTGGAGGAGCTAGAGGAG
CTGGAGCAGGAGGAATTGGCCCAGGAGTTGTTAAATGTGGGCGACAAGGAAGAAGAACCCTCAGTCAAAT
TGCCTAGTGTACCTTCTACTCATCTGCCGGCAGGGCCAGCTCCCAAAGTGGATGAAGATGAAGAAGCACT
AAAGCAGTTGGCTGAGTGGGTATCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_014169
ORF Size 798 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_014169.3, NP_054888.2
RefSeq Size 1372
RefSeq ORF 798
Locus ID 29082
Domains DUF279
Protein Pathways Endocytosis
Gene Summary CHMP4A belongs to the chromatin-modifying protein/charged multivesicular body protein (CHMP) family. These proteins are components of ESCRT-III (endosomal sorting complex required for transport III), a complex involved in degradation of surface receptor proteins and formation of endocytic multivesicular bodies (MVBs). Some CHMPs have both nuclear and cytoplasmic/vesicular distributions, and one such CHMP, CHMP1A (MIM 164010), is required for both MVB formation and regulation of cell cycle progression (Tsang et al., 2006 [PubMed 16730941]). [supplied by OMIM, Mar 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.