CHMP4A (NM_014169) Human Untagged Clone
CAT#: SC317381
CHMP4A (untagged)-Human chromatin modifying protein 4A (CHMP4A)
"NM_014169" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CHMP4A |
Synonyms | C14orf123; CHMP4; CHMP4B; HSPC134; SHAX2; SNF7; SNF7-1; VPS32-1; VPS32A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_014169, the custom clone sequence may differ by one or more nucleotides
ATGTCGCGGCGGCGCCCTGAGGACGGATTGGGCAAGGCTGGTCCCTGTGTGATGAGACATCACCCTCCCA GGAGCAAGGCGGAAGTCTGGAGGACGCTGAGGGGCGGAGGCGGGAGAGGCGAGCTCGCGATGAGTGGTCT CGGCAGGCTCTTCGGGAAGGGGAAGAAGGAGAAAGGGCCAACCCCTGAAGAAGCAATACAGAAACTGAAG GAGACAGAGAAGATACTGATCAAGAAACAGGAATTTTTGGAGCAGAAGATTCAACAGGAGCTACAAACAG CCAAGAAGTATGGGACCAAGAATAAGAGAGCTGCCCTACAGGCTTTGCGGAGGAAGAAAAGATTCGAACA GCAGCTGGCACAAACTGACGGGACATTATCCACCCTGGAGTTTCAGCGTGAGGCCATTGAGAATGCCACT ACCAATGCAGAAGTCCTTCGTACCATGGAGCTTGCTGCCCAAAGCATGAAGAAGGCCTACCAGGACATGG ACATTGACAAGGTAGATGAACTGATGACTGACATCACGGAACAACAGGAGGTGGCCCAGCAGATCTCAGA TGCCATTTCTCGGCCTATGGGCTTTGGAGATGATGTGGATGAGGATGAACTGCTGGAGGAGCTAGAGGAG CTGGAGCAGGAGGAATTGGCCCAGGAGTTGTTAAATGTGGGCGACAAGGAAGAAGAACCCTCAGTCAAAT TGCCTAGTGTACCTTCTACTCATCTGCCGGCAGGGCCAGCTCCCAAAGTGGATGAAGATGAAGAAGCACT AAAGCAGTTGGCTGAGTGGGTATCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_014169 |
ORF Size | 798 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_014169.3, NP_054888.2 |
RefSeq Size | 1372 |
RefSeq ORF | 798 |
Locus ID | 29082 |
Domains | DUF279 |
Protein Pathways | Endocytosis |
Gene Summary | CHMP4A belongs to the chromatin-modifying protein/charged multivesicular body protein (CHMP) family. These proteins are components of ESCRT-III (endosomal sorting complex required for transport III), a complex involved in degradation of surface receptor proteins and formation of endocytic multivesicular bodies (MVBs). Some CHMPs have both nuclear and cytoplasmic/vesicular distributions, and one such CHMP, CHMP1A (MIM 164010), is required for both MVB formation and regulation of cell cycle progression (Tsang et al., 2006 [PubMed 16730941]). [supplied by OMIM, Mar 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC115119 | CHMP4A (untagged)-Human chromatin modifying protein 4A (CHMP4A) |
USD 420.00 |
|
RC222002 | CHMP4A (Myc-DDK-tagged)-Human chromatin modifying protein 4A (CHMP4A) |
USD 420.00 |
|
RG222002 | CHMP4A (GFP-tagged) - Human chromatin modifying protein 4A (CHMP4A) |
USD 460.00 |
|
RC222002L1 | Lenti ORF clone of Human chromatin modifying protein 4A (CHMP4A), Myc-DDK-tagged |
USD 768.00 |
|
RC222002L2 | Lenti ORF clone of Human chromatin modifying protein 4A (CHMP4A), mGFP tagged |
USD 620.00 |
|
RC222002L3 | Lenti ORF clone of Human chromatin modifying protein 4A (CHMP4A), Myc-DDK-tagged |
USD 620.00 |
|
RC222002L4 | Lenti ORF clone of Human chromatin modifying protein 4A (CHMP4A), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review