MED8 (NM_201542) Human Untagged Clone
CAT#: SC317389
MED8 (untagged)-Human mediator complex subunit 8 (MED8), transcript variant 1
"NM_201542" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MED8 |
Synonyms | ARC32 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_201542, the custom clone sequence may differ by one or more nucleotides
ATGCAGAGAGAGGAGAAGCAGCTTGAGGCATCATTAGATGCACTGCTGAGTCAAGTGGCTGATCTGAAGA ACTCTCTGGGGAGTTTCATTTGCAAGTTGGAGAACGAGTATGGCCGGCTGACCTGGCCATCTGTCCTGGA CAGCTTTGCCTTGCTTTCTGGACAGCTGAACACTCTGAACAAGGTCTTGAAGCATGAAAAAACACCGCTG TTCCGTAACCAGGTCATCATTCCTCTGGTGTTGTCTCCAGACCGAGATGAAGATCTCATGCGGCAGACTG AAGGACGGGTGCCTGTTTTCAGCCATGAGGTAGTCCCTGACCATCTGAGAACCAAGCCTGACCCTGAAGT GGAAGAACAGGAGAAGCAACTGACGACAGATGCTGCCCGCATTGGTGCAGATGCAGCCCAGAAGCAGATC CAGAGCTTGAATAAAATGTGTTCAAACCTTCTGGAGAAAATCAGCAAAGAGGAGCGAGAATCAGAGAGTG GAGGTCTCCGGCCGAACAAGCAGACCTTTAACCCTACAGACACTAATGCCTTGGTGGCAGCTGTTGCCTT TGGGAAAGGACTATCTAATTGGAGACCTTCAGGCAGCAGTGGTCCTGGCCAGGCAGGCCAGCCAGGAGCT GGGACGATCCTTGCAGGAACCTCAGGATTACAGCAGGTGCAGATGGCAGGAGCTCCAAGCCAGCAGCAGC CAATGCTCAGTGGGGTACAAATGGCTCAGGCAGGTCAACCAGGGAAAATGCCAAGTGGAATAAAAACCAA CATCAAGTCGGCTTCCATGCATCCCTACCAGCGGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_201542 |
ORF Size | 807 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_201542.4, NP_963836.2 |
RefSeq Size | 1989 |
RefSeq ORF | 807 |
Locus ID | 112950 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene encodes a protein component of the mediator complex, which aids in transcriptional activation through interaction with RNA polymerase II and gene-specific transcription factors. The encoded protein may also function in ubiquitin ligation and protein degradation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013] Transcript Variant: This variant (5) uses an alternate exon structure in the 3' coding region and differs in the 3' UTR, compared to variant 3. The resulting isoform (4) has a shorter C-terminus, compared to isoform 3. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC319302 | MED8 (untagged)-Human mediator complex subunit 8 (MED8), transcript variant 1 |
USD 660.00 |
|
RC204026 | MED8 (Myc-DDK-tagged)-Human mediator complex subunit 8 (MED8), transcript variant 1 |
USD 420.00 |
|
RG204026 | MED8 (GFP-tagged) - Human mediator complex subunit 8 (MED8), transcript variant 1 |
USD 460.00 |
|
RC204026L3 | Lenti ORF clone of Human mediator complex subunit 8 (MED8), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC204026L4 | Lenti ORF clone of Human mediator complex subunit 8 (MED8), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review