SPI1 (NM_003120) Human Untagged Clone
CAT#: SC317391
SPI1 (untagged)-Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 2
"NM_003120" in other vectors (7)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | SPI1 |
| Synonyms | OF; PU.1; SFPI1; SPI-1; SPI-A |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_003120 edited
ATGTTACAGGCGTGCAAAATGGAAGGGTTTCCCCTCGTCCCCCCTCCATCAGAAGACCTG GTGCCCTATGACACGGATCTATACCAACGCCAAACGCACGAGTATTACCCCTATCTCAGC AGTGATGGGGAGAGCCATAGCGACCATTACTGGGACTTCCACCCCCACCACGTGCACAGC GAGTTCGAGAGCTTCGCCGAGAACAACTTCACGGAGCTCCAGAGCGTGCAGCCCCCGCAG CTGCAGCAGCTCTACCGCCACATGGAGCTGGAGCAGATGCACGTCCTCGATACCCCCATG GTGCCACCCCATCCCAGTCTTGGCCACCAGGTCTCCTACCTGCCCCGGATGTGCCTCCAG TACCCATCCCTGTCCCCAGCCCAGCCCAGCTCAGATGAGGAGGAGGGCGAGCGGCAGAGC CCCCCACTGGAGGTGTCTGACGGCGAGGCGGATGGCCTGGAGCCCGGGCCTGGGCTCCTG CCTGGGGAGACAGGCAGCAAGAAGAAGATCCGCCTGTACCAGTTCCTGTTGGACCTGCTC CGCAGCGGCGACATGAAGGACAGCATCTGGTGGGTGGACAAGGACAAGGGCACCTTCCAG TTCTCGTCCAAGCACAAGGAGGCGCTGGCGCACCGCTGGGGCATCCAGAAGGGCAACCGC AAGAAGATGACCTACCAGAAGATGGCGCGCGCGCTGCGCAACTACGGCAAGACGGGCGAG GTCAAGAAGGTGAAGAAGAAGCTCACCTACCAGTTCAGCGGCGAAGTGCTGGGCCGCGGG GGCCTGGCCGAGCGGCGCCACCCGCCCCACTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_003120 |
| ORF Size | 813 bp |
| Insert Size | 1500 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Reference Data | |
| RefSeq | NM_003120.2, NP_003111.2 |
| RefSeq Size | 1423 |
| RefSeq ORF | 813 |
| Locus ID | 6688 |
| Domains | ETS |
| Protein Families | Transcription Factors |
| Protein Pathways | Acute myeloid leukemia, Pathways in cancer |
| Gene Summary | This gene encodes an ETS-domain transcription factor that activates gene expression during myeloid and B-lymphoid cell development. The nuclear protein binds to a purine-rich sequence known as the PU-box found near the promoters of target genes, and regulates their expression in coordination with other transcription factors and cofactors. The protein can also regulate alternative splicing of target genes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1, resulting in a shorter protein (isoform 2). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| SC127924 | SPI1 (untagged)-Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 2 |
USD 660.00 |
|
| RC212818 | SPI1 (Myc-DDK-tagged)-Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 2 |
USD 300.00 |
|
| RG212818 | SPI1 (GFP-tagged) - Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 2 |
USD 460.00 |
|
| RC212818L1 | Lenti ORF clone of Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
| RC212818L2 | Lenti ORF clone of Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 2, mGFP tagged |
USD 620.00 |
|
| RC212818L3 | Lenti ORF clone of Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
| RC212818L4 | Lenti ORF clone of Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China