SLC6A15 (NM_018057) Human Untagged Clone

CAT#: SC317420

SLC6A15 (untagged)-Human solute carrier family 6 (neutral amino acid transporter), member 15 (SLC6A15), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC6A15
• Synonyms: hv7-3; NTT73; SBAT1; V7-3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_018057, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCCAAAAATAGCAAGGTGGTAAAAAGAGAATTAGATGATGATGTTACTGAGTCTGTCAAAGACCTTC
  TTTCCAATGAAGACGCAGCTGATGATGCTTTTAAGACAAGTGAACTAATTGTTGATGGCCAGGAAGAGAA
  AGATACAGATGTTGAAGAAGGATCTGAAGTCGAAGATGAAAGACCAGCTTGGAACAGTAAACTACAATAC
  ATCCTGGCCCAAGTTGGATTTTCTGTAGGTTTAGGAAATGTGTGGCGATTTCCATACCTATGTCAGAAGA
  ATGGGGGCGGTGCATATCTTTTACCATATTTAATACTACTTATGGTAATAGGTATTCCCCTTTTTTTCTT
  GGAACTCTCTGTGGGTCAAAGAATTCGGCGAGGCAGCATTGGTGTATGGAATTACATAAGCCCTAAACTG
  GGCGGGATTGGATTTGCAAGTTGTGTAGTGTGCTATTTTGTAGCTCTCTACTACAACGTCATCATTGGCT
  GGAGTTTGTTTTATTTTTCTCAGTCTTTTCAGCAACCCCTGCCTTGGGATCAGTGTCCTTTGGTGAAAAA
  TGCTTCACACACTTTTGTAGAACCAGAATGTGAACAAAGTTCTGCCACCACCTATTACTGGTACAGGGAA
  GCACTGAATATTTCAAGTTCCATTTCTGAAAGTGGGGGCTTAAACTGGAAGATGACCATCTGCTTGTTGG
  CTGCCTGGGTCATGGTTTGCTTGGCTATGATCAAAGGCATTCAGTCTTCTGGAAAAGTTAGTATGTTAGA
  GCCCTTCCTCATTCTGCTAATCACCATTTCTGGATTCATCCCTCTCTCAAATTCTGTTACAGATTTCTGT
  GGGCAAATCACACATAACACTTCATTCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_018057
• ORF Size: 870 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_018057.6, NP_060527.2
• RefSeq Size: 4276
• RefSeq ORF: 870
• Locus ID: 55117
• Domains: SNF
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
  Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.