HNRNPC (NM_031314) Human Untagged Clone

CAT#: SC317457

HNRNPC (untagged)-Human heterogeneous nuclear ribonucleoprotein C (C1/C2) (HNRNPC), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HNRNPC
• Synonyms: C1; C2; HNRNP; HNRPC; SNRPC
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_031314 edited
  ATGGCCAGCAACGTTACCAACAAGACAGATCCTCGCTCCATGAACTCCCGTGTATTCATT
  GGGAATCTCAACACTCTTGTGGTCAAGAAATCTGATGTGGAGGCAATCTTTTCGAAGTAT
  GGCAAAATTGTGGGCTGCTCTGTTCATAAGGGCTTTGCCTTCGTTCAGTATGTTAATGAG
  AGAAATGCCCGGGCTGCTGTAGCAGGAGAGGATGGCAGAATGATTGCTGGCCAGGTTTTA
  GATATTAACCTGGCTGCAGAGCCAAAAGTGAACCGAGGAAAAGCAGGTGTGAAACGATCT
  GCAGCGGAGATGTACGGGTCAGTAACAGAACACCCTTCTCCGTCCCCTCTACTCAGCTCC
  TCTTTTGACTTGGACTATGACTTTCAACGGGACTATTATGATAGGATGTACAGTTACCCA
  GCACGTGTACCTCCTCCTCCTCCTATTGCTCGGGCTGTAGTGCCCTCGAAACGTCAGCGT
  GTATCAGGAAACACTTCACGAAGGGGCAAAAGTGGCTTCAATTCTAAGAGTGGACAGCGG
  GGATCTTCCAAGTCTGGAAAGTTGAAAGGAGATGACCTTCAGGCCATTAAGAAGGAGCTG
  ACCCAGATAAAACAAAAAGTGGATTCTCTCCTGGAAAACCTGGAAAAAATTGAAAAGGAA
  CAGAGCAAACAAGCAGTAGAGATGAAGAATGATAAGTCAGAAGAGGAGCAGAGCAGCAGC
  TCCGTGAAGAAAGATGAGACTAATGTGAAGATGGAGTCTGAGGGGGGTGCAGATGACTCT
  GCTGAGGAGGGGGACCTACTGGATGATGATGATAATGAAGATCGGGGGGATGACCAGCTG
  GAGTTGATCAAGGATGATGAAAAAGAGGCTGAGGAAGGAGAGGATGACAGAGACAGCGCC
  AATGGCGAGGATGACTCTTAA
  
• Restriction Sites: NotI-NotI
• ACCN: NM_031314
• Insert Size: 2000 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_031314.2, NP_112604.2
• RefSeq Size: 3252 bp
• RefSeq ORF: 921 bp
• Locus ID: 3183
• Cytogenetics: 14q11.2
• Domains: RRM
• Protein Pathways: Spliceosome
• Gene Summary: 'This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene can act as a tetramer and is involved in the assembly of 40S hnRNP particles. Multiple transcript variants encoding at least two different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a, also known as isoform C2). Variants 1 and 3 both encode isoform a.