MFF (NM_020194) Human Untagged Clone
CAT#: SC317528
MFF (untagged)-Human mitochondrial fission factor (MFF), nuclear gene encoding mitochondrial protein
"NM_020194" in other vectors (7)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MFF |
Synonyms | C2orf33; EMPF2; GL004 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_020194, the custom clone sequence may differ by one or more nucleotides
ATGAGTAAAGGAACAAGCAGTGACACATCACTAGGAAGGGTGAGCAGGGCAGCATTTCCTTCTCCCACTG CTGCTGAGATGGCAGAAATTAGTCGAATTCAGTACGAAATGGAATATACTGAAGGCATTAGTCAGCGAAT GAGGGTCCCAGAAAAGTTAAAAGTAGCACCGCCAAACGCTGACCTGGAACAAGGATTCCAAGAAGGAGTT CCAAATGCTAGTGTGATAATGCAAGTTCCGGAGAGGATTGTTGTAGCAGGAAATAATGAAGATGTTTCAT TTTCAAGACCAGCAGATCTTGACCTTATTCAGTCAACTCCCTTTAAACCCCTGGCACTGAAAACACCACC TCGTGTACTTACGCTGAGTGAAAGACCACTAGATTTTCTGGATTTAGAAAGACCTCCTACAACCCCTCAA AATGAAGAAATCCGAGCAGTTGGCAGACTAAAAAGAGAGCGGTCTATGAGTGAAAATGCTGTTCGCCAAA ATGGACAGCTGGTCAGAAATGATTCTCTGTGGCACAGATCAGATTCTGCCCCAAGAAATAAAATTTCAAG GTTCCAGGCACCGATTTCTGCACCGGAGTACACTGTGACACCATCGCCACAACAGGCTCGGGTCTGTCCT CCCCATATGTTACCTGAAGATGGAGCTAATCTTTCCTCTGCTCGTGGCATTTTGTCGCTTATCCAGTCTT CTACTCGTAGGGCATACCAGCAGATCTTGGATGTGCTGGATGAAAATCGCAGACCTGTGTTGCGTGGTGG GTCTGCTGCCGCCACTTCTAATCCTCATCATGACAACGTCAGGTATGGCATTTCAAATATAGATACAACC ATTGAAGGAACGTCAGATGACCTGACTGTTGTAGATGCAGCTTCACTAAGACGACAGATAATCAAACTAA ATAGACGTCTACAACTTCTGGAAGAGGAGAACAAAGAACGTGCTAAAAGAGAAATGGTCATGTATTCAAT TACTGTAGCTTTCTGGCTGCTTAATAGCTGGCTCTGGTTTCGCCGCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_020194 |
ORF Size | 1029 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_020194.5, NP_064579.3 |
RefSeq Size | 2014 |
RefSeq ORF | 1029 |
Locus ID | 56947 |
Protein Families | Transmembrane |
Gene Summary | This is a nuclear gene encoding a protein that functions in mitochondrial and peroxisomal fission. The encoded protein recruits dynamin-1-like protein (DNM1L) to mitochondria. There are multiple pseudogenes for this gene on chromosomes 1, 5, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC113168 | MFF (untagged)-Human mitochondrial fission factor (MFF), nuclear gene encoding mitochondrial protein |
USD 580.00 |
|
RC221492 | MFF (Myc-DDK-tagged)-Human mitochondrial fission factor (MFF), nuclear gene encoding mitochondrial protein |
USD 420.00 |
|
RG221492 | MFF (GFP-tagged) - Human mitochondrial fission factor (MFF), nuclear gene encoding mitochondrial protein |
USD 460.00 |
|
RC221492L1 | Lenti ORF clone of Human mitochondrial fission factor (MFF), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 768.00 |
|
RC221492L2 | Lenti ORF clone of Human mitochondrial fission factor (MFF), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 620.00 |
|
RC221492L3 | Lenti ORF clone of Human mitochondrial fission factor (MFF), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 768.00 |
|
RC221492L4 | Lenti ORF clone of Human mitochondrial fission factor (MFF), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review