TRBP (TARBP2) (NM_134324) Human Untagged Clone

CAT#: SC317539

TARBP2 (untagged)-Human TAR (HIV-1) RNA binding protein 2 (TARBP2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TARBP2
• Synonyms: LOQS; TRBP; TRBP1; TRBP2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_134324, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGGCCGCCAACCCAGGCAAGACCCCGATCAGCCTTCTGCAGGAGTATGGGACCAGAATAGGGAAGA
  CGCCTGTGTACGACCTTCTCAAAGCCGAGGGCCAAGCCCACCAGCCTAATTTCACCTTCCGGGTCACCGT
  TGGCGACACCAGCTGCACTGGTCAGGGCCCCAGCAAGAAGGCAGCCAAGCACAAGGCAGCTGAGGTGGCC
  CTCAAACACCTCAAAGGGGGGAGCATGCTGGAGCCGGCCCTGGAGGACAGCAGTTCTTTTTCTCCCCTAG
  ACTCTTCACTGCCTGAGGACATTCCGGTTTTTACTGCTGCAGCAGCTGCTACCCCAGTTCCATCTGTAGT
  CCTAACCAGGAGCCCCCCCATGGAACTGCAGCCCCCTGTCTCCCCTCAGCAGTCTGAGTGCAACCCCGTT
  GGTGCTCTGCAGGAGCTGGTGGTGCAGAAAGGCTGGCGGTTGCCGGAGTACACAGTGACCCAGGAGTCTG
  GGCCAGCCCACCGCAAAGAATTCACCATGACCTGTCGAGTGGAGCGTTTCATTGAGATTGGGAGTGGCAC
  TTCCAAAAAATTGGCAAAGCGGAATGCGGCGGCCAAAATGCTGCTTCGAGTGCACACGGTGCCTCTGGAT
  GCCCGGGATGGCAATGAGGTGGAGCCTGATGATGACCACTTCTCCATTGGTGTGGGCTCCCGCCTGGATG
  GTCTTCGAAACCGGGGCCCAGGTTGCACCTGGGATTCTCTACGAAATTCAGTAGGAGAGAAGATCCTGTC
  CCTCCGCAGTTGCTCCCTGGGCTCCCTGGGTGCCCTGGGCCCTGCCTGCTGCCGTGTCCTCAGTGAGCTC
  TCTGAGGAGCAGGCCTTTCACGTCAGCTACCTGGATATTGAGGAGCTGAGCCTGAGTGGACTCTGCCAGT
  GCCTGGTGGAACTGTCCACCCAGCCGGCCACTGTGTGTCATGGCTCTGCAACCACCAGGGAGGCAGCCCG
  TGGTGAGGCTGCCCGCCGTGCCCTGCAGTACCTCAAGATCATGGCAGGCAGCAAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_134324
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_134324.2, NP_599151.2
• RefSeq Size: 1488 bp
• RefSeq ORF: 1038 bp
• Locus ID: 6895
• Cytogenetics: 12q13.13
• Protein Families: Stem cell - Pluripotency
• Gene Summary: 'HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. The protein encoded by this gene binds between the bulge and the loop of the HIV-1 TAR RNA regulatory element and activates HIV-1 gene expression in synergy with the viral Tat protein. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene also has a pseudogene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) has an alternate 5' exon and uses a downstream AUG codon for translation, as compared to variant 1. The encoded isoform (b) thus has a shorter N-terminus, as compared to isoform a.