HEXO (ERI1) (NM_153332) Human Untagged Clone

CAT#: SC317546

ERI1 (untagged)-Human exoribonuclease 1 (ERI1)


  "NM_153332" in other vectors (7)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ERI1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ERI1
Synonyms 3'HEXO; HEXO; THEX1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_153332, the custom clone sequence may differ by one or more nucleotides


ATGGAGGATCCACAGAGTAAAGAGCCTGCCGGCGAGGCCGTGGCTCTCGCGCTGCTGGAGTCGCCGCGGC
CGGAGGGCGGGGAGGAGCCGCCGCGTCCCAGTCCCGAGGAAACTCAACAGTGTAAATTTGATGGCCAGGA
GACAAAAGGATCCAAGTTCATTACCTCCAGTGCGAGTGACTTCAGTGACCCGGTTTACAAAGAGATTGCC
ATTACGAATGGCTGTATTAATAGAATGAGTAAGGAAGAACTCAGAGCTAAGCTTTCAGAATTCAAGCTTG
AAACTAGAGGAGTAAAGGATGTTCTAAAGAAGAGACTGAAAAACTATTATAAGAAGCAGAAGCTGATGCT
GAAAGAGAGCAATTTTGCTGACAGTTATTATGACTACATTTGTATTATTGACTTTGAAGCCACTTGTGAA
GAAGGAAACCCACCTGAGTTTGTACATGAAATAATTGAATTTCCGGTTGTTTTACTGAATACGCATACTT
TAGAAATAGAAGACACGTTTCAGCAGTATGTAAGACCAGAGATTAACACACAGCTGTCTGATTTCTGCAT
CAGTCTAACTGGAATTACTCAGGATCAGGTAGACAGAGCTGATACCTTCCCTCAGGTACTAAAAAAAGTA
ATTGACTGGATGAAATTGAAGGAATTAGGAACAAAGTATAAATACTCACTTTTAACAGATGGTTCTTGGG
ATATGAGTAAGTTCTTGAACATTCAGTGTCAACTCAGCAGGCTCAAATACCCTCCTTTTGCGAAAAAGTG
GATCAATATTCGGAAGTCATATGGAAATTTTTACAAGGTTCCTAGAAGCCAAACCAAACTGACAATAATG
CTTGAAAAATTAGGAATGGATTATGATGGGCGGCCTCACTGTGGTCTTGATGACTCTAAGAATATCGCCC
GAATAGCAGTTCGAATGCTTCAGGATGGGTGTGAACTCCGAATCAACGAGAAAATGCATGCAGGACAGCT
AATGAGTGTGTCCTCTTCCTTACCAATAGAGGGCACTCCACCACCACAAATGCCACATTTTAGAAAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_153332
ORF Size 1050 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_153332.3, NP_699163.2
RefSeq Size 4615
RefSeq ORF 1050
Locus ID 90459
Gene Summary RNA exonuclease that binds to the 3'-end of histone mRNAs and degrades them, suggesting that it plays an essential role in histone mRNA decay after replication. A 2' and 3'-hydroxyl groups at the last nucleotide of the histone 3'-end is required for efficient degradation of RNA substrates. Also able to degrade the 3'-overhangs of short interfering RNAs (siRNAs) in vitro, suggesting a possible role as regulator of RNA interference (RNAi). Requires for binding the 5'-ACCCA-3' sequence present in stem-loop structure. Able to bind other mRNAs. Required for 5.8S rRNA 3'-end processing. Also binds to 5.8s ribosomal RNA. Binds with high affinity to the stem-loop structure of replication-dependent histone pre-mRNAs. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.