PPM1L (NM_139245) Human Untagged Clone

CAT#: SC317574

PPM1L (untagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1L (PPM1L)


  "NM_139245" in other vectors (7)

Reconstitution Protocol

SC317574 is the updated version of SC120685.

USD 610.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PPM1L"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PPM1L
Synonyms PP2C-epsilon; PP2CE; PPM1-LIKE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_139245, the custom clone sequence may differ by one or more nucleotides


ATGATAGAGGATACAATGACTTTGCTGTCTCTGCTGGGTCGCATCATGCGCTACTTCTTGCTGAGACCCG
AGACGCTTTTCCTGCTGTGCATCAGCTTGGCTCTATGGAGTTACTTCTTCCACACCGACGAGGTGAAGAC
CATCGTGAAGTCCAGCCGGGACGCCGTGAAGATGGTGAAGGGCAAGGTAGCCGAGATCATGCAGAACGAT
CGACTCGGGGGGCTTGATGTGCTCGAGGCCGAGTTTTCCAAGACCTGGGAGTTCAAGAACCACAACGTGG
CGGTGTACTCCATCCAGGGCCGGAGAGACCACATGGAGGACCGCTTCGAAGTTCTCACGGATCTGGCCAA
CAAGACGCACCCGTCCATCTTCGGGATCTTCGACGGGCACGGGGGAGAGACTGCAGCTGAATATGTAAAA
TCTCGACTCCCAGAGGCCCTTAAACAGCATCTTCAGGACTACGAGAAAGACAAAGAAAATAGTGTATTAT
CTTACCAGACCATCCTTGAACAGCAGATTTTGTCAATTGACCGAGAAATGCTAGAAAAATTGACTGTATC
CTATGATGAAGCAGGCACAACGTGTTTGATTGCTCTGCTATCAGATAAAGACCTCACTGTGGCCAACGTG
GGTGACTCGCGCGGGGTCCTGTGTGACAAAGATGGGAACGCTATTCCTTTGTCTCATGATCACAAGCCTT
ACCAGTTGAAGGAAAGAAAGAGGATAAAGAGAGCAGGTGGTTTCATCAGTTTCAATGGCTCCTGGAGGGT
CCAGGGAATCCTGGCCATGTCTCGGTCCCTGGGGGATTATCCGCTGAAAAATCTCAACGTGGTCATCCCA
GACCCAGACATCCTGACCTTTGACCTGGACAAGCTTCAGCCTGAGTTCATGATCTTGGCATCAGATGGTC
TCTGGGATGCTTTCAGCAATGAAGAAGCAGTTCGATTCATCAAGGAGCGCTTGGATGAACCTCACTTTGG
GGCCAAGAGCATAGTTTTACAGTCATTTTACAGAGGCTGCCCTGACAATATAACAGTCATGGTGGTGAAG
TTCAGAAATAGCAGCAAAACAGAAGAGCAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_139245
ORF Size 1083 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_139245.3, NP_640338.2
RefSeq Size 10945
RefSeq ORF 1083
Locus ID 151742
Domains PP2C
Protein Families Druggable Genome, Phosphatase
Gene Summary The protein encoded by this gene is a magnesium or manganese-requiring phosphatase that is involved in several signaling pathways. The encoded protein downregulates apoptosis signal-regulating kinase 1, a protein that initiates a signaling cascade that leads to apoptosis when cells are subjected to cytotoxic stresses. This protein also is an endoplasmic reticulum transmembrane protein that helps regulate ceramide transport from the endoplasmic reticulum to the Golgi apparatus. Finally, this gene may be involved in adiposity since it is upregulated in adipose tissues. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.