PPM1L (NM_139245) Human Untagged Clone
CAT#: SC317574
PPM1L (untagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1L (PPM1L)
"NM_139245" in other vectors (7)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PPM1L |
Synonyms | PP2C-epsilon; PP2CE; PPM1-LIKE |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_139245, the custom clone sequence may differ by one or more nucleotides
ATGATAGAGGATACAATGACTTTGCTGTCTCTGCTGGGTCGCATCATGCGCTACTTCTTGCTGAGACCCG AGACGCTTTTCCTGCTGTGCATCAGCTTGGCTCTATGGAGTTACTTCTTCCACACCGACGAGGTGAAGAC CATCGTGAAGTCCAGCCGGGACGCCGTGAAGATGGTGAAGGGCAAGGTAGCCGAGATCATGCAGAACGAT CGACTCGGGGGGCTTGATGTGCTCGAGGCCGAGTTTTCCAAGACCTGGGAGTTCAAGAACCACAACGTGG CGGTGTACTCCATCCAGGGCCGGAGAGACCACATGGAGGACCGCTTCGAAGTTCTCACGGATCTGGCCAA CAAGACGCACCCGTCCATCTTCGGGATCTTCGACGGGCACGGGGGAGAGACTGCAGCTGAATATGTAAAA TCTCGACTCCCAGAGGCCCTTAAACAGCATCTTCAGGACTACGAGAAAGACAAAGAAAATAGTGTATTAT CTTACCAGACCATCCTTGAACAGCAGATTTTGTCAATTGACCGAGAAATGCTAGAAAAATTGACTGTATC CTATGATGAAGCAGGCACAACGTGTTTGATTGCTCTGCTATCAGATAAAGACCTCACTGTGGCCAACGTG GGTGACTCGCGCGGGGTCCTGTGTGACAAAGATGGGAACGCTATTCCTTTGTCTCATGATCACAAGCCTT ACCAGTTGAAGGAAAGAAAGAGGATAAAGAGAGCAGGTGGTTTCATCAGTTTCAATGGCTCCTGGAGGGT CCAGGGAATCCTGGCCATGTCTCGGTCCCTGGGGGATTATCCGCTGAAAAATCTCAACGTGGTCATCCCA GACCCAGACATCCTGACCTTTGACCTGGACAAGCTTCAGCCTGAGTTCATGATCTTGGCATCAGATGGTC TCTGGGATGCTTTCAGCAATGAAGAAGCAGTTCGATTCATCAAGGAGCGCTTGGATGAACCTCACTTTGG GGCCAAGAGCATAGTTTTACAGTCATTTTACAGAGGCTGCCCTGACAATATAACAGTCATGGTGGTGAAG TTCAGAAATAGCAGCAAAACAGAAGAGCAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_139245 |
ORF Size | 1083 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_139245.3, NP_640338.2 |
RefSeq Size | 10945 |
RefSeq ORF | 1083 |
Locus ID | 151742 |
Domains | PP2C |
Protein Families | Druggable Genome, Phosphatase |
Gene Summary | The protein encoded by this gene is a magnesium or manganese-requiring phosphatase that is involved in several signaling pathways. The encoded protein downregulates apoptosis signal-regulating kinase 1, a protein that initiates a signaling cascade that leads to apoptosis when cells are subjected to cytotoxic stresses. This protein also is an endoplasmic reticulum transmembrane protein that helps regulate ceramide transport from the endoplasmic reticulum to the Golgi apparatus. Finally, this gene may be involved in adiposity since it is upregulated in adipose tissues. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC125344 | PPM1L (untagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1L (PPM1L) |
USD 610.00 |
|
RC218909 | PPM1L (Myc-DDK-tagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1L (PPM1L) |
USD 420.00 |
|
RG218909 | PPM1L (GFP-tagged) - Human protein phosphatase, Mg2+/Mn2+ dependent, 1L (PPM1L) |
USD 460.00 |
|
RC218909L1 | Lenti ORF clone of Human protein phosphatase, Mg2+/Mn2+ dependent, 1L (PPM1L), Myc-DDK-tagged |
USD 768.00 |
|
RC218909L2 | Lenti ORF clone of Human protein phosphatase, Mg2+/Mn2+ dependent, 1L (PPM1L), mGFP tagged |
USD 620.00 |
|
RC218909L3 | Lenti ORF clone of Human protein phosphatase, Mg2+/Mn2+ dependent, 1L (PPM1L), Myc-DDK-tagged |
USD 620.00 |
|
RC218909L4 | Lenti ORF clone of Human protein phosphatase, Mg2+/Mn2+ dependent, 1L (PPM1L), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review