SYT8 (NM_138567) Human Untagged Clone

CAT#: SC317636

SYT8 (untagged)-Human synaptotagmin VIII (SYT8)


  "NM_138567" in other vectors (6)

Reconstitution Protocol

USD 680.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SYT8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SYT8
Synonyms DKFZp434K0322
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_138567, the custom clone sequence may differ by one or more nucleotides


ATGCTCCACCTGCATGGCTGGCAAACCATGCAGGGTAGAAAGATGGGGCACCCACCAGTCTCTCCCAGTG
CCCCGGCCCCAGCTGGCACCACAGCTATACCTGGGCTTATTCCAGACCTTGTCGCCGGGACCCCCTGGCC
CCGCTGGGCTCTCATTGCCGGCGCCCTTGCCGCGGGCGTCCTCCTCGTCTCCTGCCTCCTCTGTGCTGCC
TGCTGCTGCTGCCGCCGCCACAGGAAGAAGCCCAGGGACAAGGAGTCCGTGGGTCTGGGCAGTGCCCGCG
GCACCACCACCACCCACCTGGTGCAACCTGATGTGGATGGCCTGGAGTCCAGCCCGGGGGATGCTCAGCA
ATGGGGGCGCCTGCAGCTCTCCCTGGAGTTCGACTTTGGAAGCCAGGAGATCAGGGTGGGCCTGAGGCAG
GCAGCCGACCTGAGGCCTGGGGGCACCGTGGACCCCTATGCCCGGGTCAGCGTCTCCACCCAGGCCGGAC
ACAGACATGAGACAAAAGTGCACCGAGGCACGCTCTGCCCCGTGTTTGACGAGACCTGCTGCTTCCACAT
CCCGCAGGCGGAGCTGCCAGGGGCCACCCTGCAGGTGCAGCTTTTCAACTTCAAGCGCTTCTCGGGGCAT
GAGCCCCTGGGTGAGCTCCGTCTGCCACTGGGCACCGTGGATCTGCAGCATGTTCTGGAGCACTGGTACC
TGCTGGGCCCGCCGGCTGCCACTCAGCCCGAGCAGGTCGGGGAGCTGTGCTTCTCTCTCCGGTACGTGCC
CAGCTCAGGCCGGCTGACCGTGGTGGTGCTGGAGGCTCGAGGCCTGCGTCCAGGACTTGCAGAGCCCTAC
GTGAAGGTCCAGCTCATGCTGAACCAGAGGAAGTGGAAGAAGAGAAAGACAGCCACCAAAAAGGGCACGG
CGGCCCCCTACTTCAATGAGGCCTTCACCTTCCTGGTGCCCTTCAGCCAGGTCCAGAATGTGGACCTGGT
GCTGGCTGTCTGGGACCGCAGCCTGCCGCTCCGAACTGAGCCCGTAGGCAAGGTGCACCTGGGTGCCCGG
GCCTCGGGGCAGCCCCTGCAGCACTGGGCAGACATGCTGGCCCACGCCCGGCGGCCCATTGCCCAGCGGC
ACCCCCTGCGGCCAGCCAGGGAGGTGGACCGCATGCTGGCCCTGCAGCCCCGCCTTCGCCTGCGCCTGCC
CTTGCCCCACTCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_138567
ORF Size 1206 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_138567.4, NP_612634.3
RefSeq Size 1558
RefSeq ORF 1206
Locus ID 90019
Protein Families Transmembrane
Gene Summary This gene encodes a member of the synaptotagmin protein family. Synaptotagmins are membrane proteins that are important in neurotransmission and hormone secretion, both of which involve regulated exocytosis. Expression of the encoded protein in human pancreatic islets has been connected to activity of the promoter for the insulin gene, on the same chromosome several hundred kilobases away (PMID: 21336277 and 22928559). This association would link response to gluclose to insulin secretion. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (2) uses an alternate in-frame splice site, and an alternate upstream translation start, compared to variant 1. The encoded protein (isoform 2) is shorter and has a distinct N-terminus, compared to isoform 1. CCDS Note: The coding region has been updated to represent an alternative 3' splice pattern, resulting in a longer and distinct C-terminus that is better supported by available transcript and homology data. The update adds two C2 domains (Ca2+-dependent membrane-targeting modules), which are hallmarks of synaptotagmin proteins.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.