HS6ST1 (NM_004807) Human Untagged Clone

CAT#: SC317658

HS6ST1 (untagged)-Human heparan sulfate 6-O-sulfotransferase 1 (HS6ST1)


  "NM_004807" in other vectors (6)

Reconstitution Protocol

USD 760.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "HS6ST1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HS6ST1
Synonyms HH15; HS6ST
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_004807, the custom clone sequence may differ by one or more nucleotides


ATGCGGCGGCGGCGCGCCGGCGGCAGGACCATGGTTGAGCGCGCCAGCAAGTTCGTGCTGGTGGTGGCGG
GCTCGGTGTGCTTCATGCTCATCTTGTACCAGTACGCGGGCCCAGGACTGAGCCTGGGCGCGCCCGGCGG
CCGCGCGCCGCCCGACGACCTGGACCTGTTCCCCACACCCGACCCCCACTACGAGAAGAAGTACTACTTC
CCGGTCCGCGAGCTGGAGCGCTCGCTGCGCTTCGACATGAAGGGCGACGACGTGATCGTCTTCCTGCACA
TCCAGAAGACGGGCGGCACCACCTTCGGCCGCCACCTCGTGCAGAACGTACGCCTCGAGGTGCCGTGCGA
CTGCCGGCCCGGCCAGAAGAAGTGCACCTGCTACCGGCCCAACCGCCGCGAGACTTGGCTCTTCTCCCGC
TTCTCCACCGGCTGGAGCTGCGGGCTGCACGCCGACTGGACCGAGCTCACCAACTGCGTGCCCGGCGTGC
TGGACCGCCGCGACTCCGCCGCGCTGCGCACGCCCAGGAAGTTCTACTACATCACCCTGCTACGAGACCC
CGTGTCCCGCTACCTGAGCGAGTGGCGGCATGTGCAGAGGGGTGCCACGTGGAAGACGTCGTTGCATATG
TGTGATGGGCGCACGCCCACGCCTGAGGAGCTGCCGCCCTGCTACGAGGGCACGGACTGGTCGGGCTGCA
CGCTACAGGAGTTCATGGACTGCCCGTACAACCTGGCCAACAACCGCCAGGTGCGCATGCTGGCCGACCT
GAGCCTGGTGGGCTGCTACAACCTGTCCTTCATCCCCGAGGGCAAGCGGGCCCAGCTGCTGCTCGAGAGC
GCCAAGAAGAACCTGCGGGGCATGGCCTTCTTCGGCCTGACCGAGTTCCAGCGCAAGACGCAGTACCTGT
TCGAGCGGACGTTCAACCTCAAGTTCATCCGGCCCTTCATGCAGTACAATAGCACGCGGGCGGGCGGCGT
GGAGGTGGATGAAGACACCATCCGGCGCATCGAGGAGCTCAACGACCTGGACATGCAGCTGTACGACTAC
GCCAAGGACCTCTTCCAGCAGCGCTACCAGTACAAGCGGCAGCTGGAGCGCAGGGAGCAGCGCCTGAGGA
GCCGCGAGGAGCGTCTGCTGCACCGGGCCAAGGAGGCACTGCCGCGGGAGGATGCCGACGAGCCGGGCCG
CGTGCCCACCGAGGACTACATGAGCCACATCATTGAGAAGTGGTAG


Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites Please inquire     
ACCN NM_004807
ORF Size 1236 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_004807.2, NP_004798.3
RefSeq Size 3966
RefSeq ORF 1236
Locus ID 9394
Protein Families Transmembrane
Protein Pathways Heparan sulfate biosynthesis
Gene Summary The protein encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biological activities. This enzyme is a type II integral membrane protein and is responsible for 6-O-sulfation of heparan sulfate. This enzyme does not share significant sequence similarity with other known sulfotransferases. A pseudogene located on chromosome 1 has been found for this gene. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.