HS6ST1 (NM_004807) Human Untagged Clone
CAT#: SC317658
HS6ST1 (untagged)-Human heparan sulfate 6-O-sulfotransferase 1 (HS6ST1)
"NM_004807" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HS6ST1 |
Synonyms | HH15; HS6ST |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_004807, the custom clone sequence may differ by one or more nucleotides
ATGCGGCGGCGGCGCGCCGGCGGCAGGACCATGGTTGAGCGCGCCAGCAAGTTCGTGCTGGTGGTGGCGG GCTCGGTGTGCTTCATGCTCATCTTGTACCAGTACGCGGGCCCAGGACTGAGCCTGGGCGCGCCCGGCGG CCGCGCGCCGCCCGACGACCTGGACCTGTTCCCCACACCCGACCCCCACTACGAGAAGAAGTACTACTTC CCGGTCCGCGAGCTGGAGCGCTCGCTGCGCTTCGACATGAAGGGCGACGACGTGATCGTCTTCCTGCACA TCCAGAAGACGGGCGGCACCACCTTCGGCCGCCACCTCGTGCAGAACGTACGCCTCGAGGTGCCGTGCGA CTGCCGGCCCGGCCAGAAGAAGTGCACCTGCTACCGGCCCAACCGCCGCGAGACTTGGCTCTTCTCCCGC TTCTCCACCGGCTGGAGCTGCGGGCTGCACGCCGACTGGACCGAGCTCACCAACTGCGTGCCCGGCGTGC TGGACCGCCGCGACTCCGCCGCGCTGCGCACGCCCAGGAAGTTCTACTACATCACCCTGCTACGAGACCC CGTGTCCCGCTACCTGAGCGAGTGGCGGCATGTGCAGAGGGGTGCCACGTGGAAGACGTCGTTGCATATG TGTGATGGGCGCACGCCCACGCCTGAGGAGCTGCCGCCCTGCTACGAGGGCACGGACTGGTCGGGCTGCA CGCTACAGGAGTTCATGGACTGCCCGTACAACCTGGCCAACAACCGCCAGGTGCGCATGCTGGCCGACCT GAGCCTGGTGGGCTGCTACAACCTGTCCTTCATCCCCGAGGGCAAGCGGGCCCAGCTGCTGCTCGAGAGC GCCAAGAAGAACCTGCGGGGCATGGCCTTCTTCGGCCTGACCGAGTTCCAGCGCAAGACGCAGTACCTGT TCGAGCGGACGTTCAACCTCAAGTTCATCCGGCCCTTCATGCAGTACAATAGCACGCGGGCGGGCGGCGT GGAGGTGGATGAAGACACCATCCGGCGCATCGAGGAGCTCAACGACCTGGACATGCAGCTGTACGACTAC GCCAAGGACCTCTTCCAGCAGCGCTACCAGTACAAGCGGCAGCTGGAGCGCAGGGAGCAGCGCCTGAGGA GCCGCGAGGAGCGTCTGCTGCACCGGGCCAAGGAGGCACTGCCGCGGGAGGATGCCGACGAGCCGGGCCG CGTGCCCACCGAGGACTACATGAGCCACATCATTGAGAAGTGGTAG |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | Please inquire |
ACCN | NM_004807 |
ORF Size | 1236 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_004807.2, NP_004798.3 |
RefSeq Size | 3966 |
RefSeq ORF | 1236 |
Locus ID | 9394 |
Protein Families | Transmembrane |
Protein Pathways | Heparan sulfate biosynthesis |
Gene Summary | The protein encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biological activities. This enzyme is a type II integral membrane protein and is responsible for 6-O-sulfation of heparan sulfate. This enzyme does not share significant sequence similarity with other known sulfotransferases. A pseudogene located on chromosome 1 has been found for this gene. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219550 | HS6ST1 (Myc-DDK-tagged)-Human heparan sulfate 6-O-sulfotransferase 1 (HS6ST1) |
USD 420.00 |
|
RG219550 | HS6ST1 (GFP-tagged) - Human heparan sulfate 6-O-sulfotransferase 1 (HS6ST1) |
USD 460.00 |
|
RC219550L1 | Lenti ORF clone of Human heparan sulfate 6-O-sulfotransferase 1 (HS6ST1), Myc-DDK-tagged |
USD 768.00 |
|
RC219550L2 | Lenti ORF clone of Human heparan sulfate 6-O-sulfotransferase 1 (HS6ST1), mGFP tagged |
USD 620.00 |
|
RC219550L3 | Lenti ORF clone of Human heparan sulfate 6-O-sulfotransferase 1 (HS6ST1), Myc-DDK-tagged |
USD 620.00 |
|
RC219550L4 | Lenti ORF clone of Human heparan sulfate 6-O-sulfotransferase 1 (HS6ST1), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review