Pregnancy Specific Glycoprotein 1 (PSG1) (NM_006905) Human Untagged Clone

CAT#: SC317687

PSG1 (untagged)-Human pregnancy specific beta-1-glycoprotein 1 (PSG1), transcript variant 1


  "NM_006905" in other vectors (8)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PSG1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PSG1
Synonyms B1G1; CD66f; DHFRP2; FL-NCA-1/2; PBG1; PS-beta-C/D; PS-beta-G-1; PSBG-1; PSBG1; PSG95; PSGGA; PSGIIA; SP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_006905, the custom clone sequence may differ by one or more nucleotides


ATGGGAACCCTCTCAGCCCCTCCCTGCACACAGCGCATCAAATGGAAGGGGCTCCTGCTCACAGCATCAC
TTTTAAACTTCTGGAACCTGCCCACCACTGCCCAAGTCACGATTGAAGCCGAGCCAACCAAAGTTTCCGA
GGGGAAGGATGTTCTTCTACTTGTCCACAATTTGCCCCAGAATCTTACCGGCTACATCTGGTACAAAGGG
CAAATGAGGGACCTCTACCATTACATTACATCATATGTAGTAGACGGTGAAATAATTATATATGGGCCTG
CATATAGTGGACGAGAAACAGCATATTCCAATGCATCCCTGCTGATCCAGAATGTCACCCGGGAGGACGC
AGGATCCTACACCTTACACATCATAAAGGGAGATGATGGGACTAGAGGAGTAACTGGACGTTTCACCTTC
ACCTTACACCTGGAGACTCCTAAGCCCTCCATCTCCAGCAGCAACTTAAATCCCAGGGAGACCATGGAGG
CTGTGAGCTTAACCTGTGACCCTGAGACTCCAGACGCAAGCTACCTGTGGTGGATGAATGGTCAGAGCCT
CCCTATGACTCACAGCTTGAAGCTGTCCGAAACCAACAGGACCCTCTTTCTATTGGGTGTCACAAAGTAT
ACTGCAGGACCCTATGAATGTGAAATACGGAACCCAGTGAGTGCCAGCCGCAGTGACCCAGTCACCCTGA
ATCTCCTCCCGAAGCTGCCCAAGCCCTACATCACCATCAACAACTTAAACCCCAGGGAGAATAAGGATGT
CTTAAACTTCACCTGTGAACCTAAGAGTGAGAACTACACCTACATTTGGTGGCTAAATGGTCAGAGCCTC
CCGGTCAGTCCCAGGGTAAAGCGACCCATTGAAAACAGGATCCTCATTCTACCCAGTGTCACGAGAAATG
AAACAGGACCCTATCAATGTGAAATACGGGACCGATATGGTGGCATCCGCAGTGACCCAGTCACCCTGAA
TGTCCTCTATGGTCCAGACCTCCCCAGAATTTACCCTTCATTCACCTATTACCGTTCAGGAGAAGTCCTC
TACTTGTCCTGTTCTGCGGACTCTAACCCACCGGCACAGTATTCTTGGACAATTAATGAAAAGTTTCAGC
TACCAGGACAAAAGCTCTTTATCCGCCATATTACTACAAAGCATAGCGGGCTCTATGTTTGCTCTGTTCG
TAACTCAGCCACTGGCAAGGAAAGCTCCAAATCCATGACAGTCGAAGTCTCTGGTAAGTGGATCCCAGCA
TCGTTGGCAATAGGGTTTTAG


Restriction Sites SgfI-MluI     
ACCN NM_006905
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006905.2, NP_008836.2
RefSeq Size 2306 bp
RefSeq ORF 1281 bp
Locus ID 5669
Cytogenetics 19q13.2
Domains ig, IGc2, IG
Protein Families Secreted Protein
Gene Summary 'The human placenta is a multihormonal endocrine organ that produces hormones, enzymes, and other molecules that support fetal survival and development. Pregnancy-specific beta-1-glycoprotein (PSBG, PSG) is a major product of the syncytiotrophoblast, reaching concentrations of 100 to 290 mg/l at term in the serum of pregnant women (Horne et al., 1976 [PubMed 971765]). PSG is a member of the immunoglobulin (Ig) superfamily (Watanabe and Chou, 1988 [PubMed 3257488]; Streydio et al., 1988 [PubMed 3260773]).[supplied by OMIM, Oct 2009]'
Transcript Variant: This variant (1) uses alternate splice sites in the 3' terminal exon, compared to variant 4. It encodes isoform 1, which has a shorter and distinct C-terminus, compared to isoform 4. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.