PSMC3 (NM_002804) Human Untagged Clone

CAT#: SC317718

PSMC3 (untagged)-Human proteasome (prosome, macropain) 26S subunit, ATPase, 3 (PSMC3)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PSMC3
• Synonyms: TBP1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_002804, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAATCTGCTGCCGAATATTGAGAGTCCAGTGACTCGGCAGGAGAAGATGGCGACCGTGTGGGATGAGG
  CCGAGCAAGATGGAATTGGGGAGGAGGTGCTCAAGATGTCCACGGAGGAGATCATCCAGCGCACACGGCT
  GCTGGACAGTGAGATCAAGATCATGAAGAGTGAAGTGTTGAGAGTCACCCATGAGCTCCAAGCCATGAAG
  GACAAGATAAAAGAGAACAGTGAGAAAATCAAAGTGAACAAGACCCTGCCGTACCTTGTCTCCAACGTCA
  TCGAGCTCCTGGATGTTGATCCTAATGACCAAGAGGAGGATGGTGCCAATATTGACCTGGACTCCCAGAG
  GAAGGGCAAGTGTGCTGTGATCAAAACCTCTACACGACAGACGTACTTCCTTCCTGTGATTGGGTTGGTG
  GATGCTGAAAAGCTAAAGCCAGGAGACCTGGTGGGTGTGAACAAAGACTCCTATCTGATCCTGGAGACGC
  TGCCCACAGAGTATGACTCGCGGGTGAAGGCCATGGAGGTAGACGAGAGGCCCACGGAGCAATACAGTGA
  CATTGGGGGTTTGGACAAGCAGATCCAGGAGCTGGTGGAGGCCATTGTCTTGCCAATGAACCACAAGGAG
  AAGTTTGAGAACTTGGGGATCCAACCTCCAAAAGGGGTGCTGATGTATGGGCCCCCAGGGACGGGGAAGA
  CCCTCCTGGCCCGGGCCTGTGCCGCACAGACTAAGGCCACCTTCCTAAAGCTGGCTGGCCCCCAGCTGGT
  GCAGATGTTCATTGGAGATGGTGCCAAGCTAGTCCGGGATGCCTTTGCCCTGGCCAAGGAGAAAGCGCCC
  TCTATCATCTTCATTGATGAGTTGGATGCCATCGGCACCAAGCGCTTTGACAGTGAGAAGGCTGGGGACC
  GGGAGGTGCAGAGGACAATGCTGGAGCTTCTGAACCAGCTGGATGGCTTCCAGCCCAACACCCAAGTTAA
  GGTAATTGCAGCCACAAACAGGGTGGACATCCTGGACCCCGCCCTCCTCCGCTCGGGCCGCCTTGACCGC
  AAGATAGAGTTCCCGATGCCCAATGAGGAGGCCCGGGCCAGAATCATGCAGATCCACTCCCGAAAGATGA
  ATGTCAGTCCTGACGTGAACTACGAGGAGCTGGCCCGCTGCACAGATGACTTCAATGGGGCCCAGTGCAA
  GGCTGTGTGTGTGGAGGCGGGCATGATCGCACTGCGCAGGGGTGCCACGGAGCTCACCCACGAGGACTAC
  ATGGAAGGCATCCTGGAGGTGCAGGCCAAGAAGAAAGCCAACCTACAATACTACGCCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_002804
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_002804.4, NP_002795.2
• RefSeq Size: 1618 bp
• RefSeq ORF: 1320 bp
• Locus ID: 5702
• Cytogenetics: 11p11.2
• Domains: AAA, AAA
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: Proteasome
• Gene Summary: 'The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases that have chaperone-like activity. This subunit may compete with PSMC2 for binding to the HIV tat protein to regulate the interaction between the viral protein and the transcription complex. A pseudogene has been identified on chromosome 9. [provided by RefSeq, Jul 2008]'