NDUFV3 (NM_021075) Human Untagged Clone
CAT#: SC317780
NDUFV3 (untagged)-Human NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa (NDUFV3), nuclear gene encoding mitochondrial protein, transcript variant 1
"NM_021075" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NDUFV3 |
Synonyms | CI-9KD; CI-10k |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_021075, the custom clone sequence may differ by one or more nucleotides
ATGGCTGCCCCGTGTTTGCTGCGGCAAGGACGAGCCGGGGCGCTGAAGACTATGCTCCAGGAAGCCCAGG TGTTTCGAGGACTTGCTTCTACGGTTTCTTTGTCTGCGGAATCAGGGAAGAGTGAAAAGGGTCAGCCACA GAATTCCAAGAAGCAAAGTCCACCAAAAAATGTAGTGGAACCAAAGGAGAGGGGCAAGCTCCTAGCCACC CAGACAGCAGCTGAATTGTCTAAAAACTTATCTTCACCCAGTTCTTACCCGCCAGCTGTGAATAAGGGCA GGAAGGTAGCTAGTCCCAGTCCCAGTGGCAGCGTGCTATTCACAGATGAAGGGGTTCCGAAATTTTTGTC AAGAAAGACTTTGGTAGAGTTTCCACAGAAAGTTCTGTCTCCATTCAGAAAACAGGGCTCTGATTCAGAA GCTCGTCAGGTGGGTCGGAAAGTGACGTCGCCTTCGTCTTCATCCTCTTCCAGCTCCTCTGATTCTGAAT CTGATGATGAGGCTGACGTTTCAGAGGTCACTCCTCGAGTGGTGAGCAAAGGCAGAGGGGGGCTTCGAAA ACCAGAGGCCTCTCATTCCTTTGAAAACAGAGCCCCCCGAGTTACAGTATCAGCAAAAGAGAAAACCTTG CTGCAGAAGCCGCATGTGGACATTACTGATCCAGAGAAGCCCCACCAGCCAAAGAAGAAAGGGTCCCCTG CTAAGCCATCAGAAGGCAGGGAAAATGCGAGACCAAAAACCACAATGCCCAGATCTCAAGTAGATGAAGA GTTTTTGAAGCAAAGTTTAAAGGAAAAACAATTGCAGAAAACATTTAGATTAAATGAAATAGATAAAGAA AGCCAAAAGCCATTTGAAGTTAAAGGACCCTTACCTGTCCACACAAAATCAGGGTTGTCTGCGCCACCGA AGGGCAGCCCAGCGCCTGCTGTGTTGGCAGAAGAGGCCAGAGCAGAGGGGCAGCTGCAAGCCAGTCCTCC TGGGGCGGCAGAGGGGCATCTGGAAAAACCCGTGCCAGAGCCCCAGCGCAAGGCGGCCCCTCCCCTGCCC AGAAAGGAAACCTCAGGGACGCAGGGAATAGAAGGCCACCTGAAGGGTGGACAGGCAATCGTGGAAGATC AGATACCACCAAGCAATTTGGAGACAGTTCCTGTTGAGAATAACCACGGTTTCCATGAAAAGACAGCAGC GCTGAAGCTTGAGGCCGAGGGCGAGGCCATGGAAGATGCAGCCGCGCCAGGGGACGACCGAGGCGGCACA CAGGAGCCAGCCCCAGTGCCTGCTGAGCCGTTTGACAACACTACCTACAAGAACCTGCAGCATCATGACT ACAGCACGTACACCTTCTTAGACCTCAACCTCGAACTCTCAAAATTCAGGATGCCTCAGCCCTCCTCAGG CCGGGAGTCACCTCGACACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_021075 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_021075.3, NP_066553.3 |
RefSeq Size | 2151 bp |
RefSeq ORF | 1422 bp |
Locus ID | 4731 |
Cytogenetics | 21q22.3 |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
Gene Summary | 'The protein encoded by this gene is one of at least forty-one subunits that make up the NADH-ubiquinone oxidoreductase complex. This complex is part of the mitochondrial respiratory chain and serves to catalyze the rotenone-sensitive oxidation of NADH and the reduction of ubiquinone. The encoded protein is one of three proteins found in the flavoprotein fraction of the complex. The specific function of the encoded protein is unknown. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC113024 | NDUFV3 (untagged)-Human NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa (NDUFV3), nuclear gene encoding mitochondrial protein, transcript variant 1 |
USD 310.00 |
|
SC320325 | NDUFV3 (untagged)-Human NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa (NDUFV3), nuclear gene encoding mitochondrial protein, transcript variant 1 |
USD 310.00 |
|
RC202915 | NDUFV3 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa (NDUFV3), nuclear gene encoding mitochondrial protein, transcript variant 1 |
USD 420.00 |
|
RG202915 | NDUFV3 (GFP-tagged) - Human NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa (NDUFV3), nuclear gene encoding mitochondrial protein, transcript variant 1 |
USD 460.00 |
|
RC202915L3 | Lenti ORF clone of Human NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa (NDUFV3), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC202915L4 | Lenti ORF clone of Human NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa (NDUFV3), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review