HDAC2 (NM_001527) Human Untagged Clone

CAT#: SC318000

HDAC2 (untagged)-Human histone deacetylase 2 (HDAC2), transcript variant 1


  "NM_001527" in other vectors (8)

Reconstitution Protocol

USD 820.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "HDAC2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HDAC2
Synonyms HD2; KDAC2; RPD3; YAF1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001527, the custom clone sequence may differ by one or more nucleotides


ATGGCGTACAGTCAAGGAGGCGGCAAAAAAAAAGTCTGCTACTACTACGACGGTGATATTGGAAATTATT
ATTATGGACAGGGTCATCCCATGAAGCCTCATAGAATCCGCATGACCCATAACTTGCTGTTAAATTATGG
CTTATACAGAAAAATGGAAATATATAGGCCCCATAAAGCCACTGCCGAAGAAATGACAAAATATCACAGT
GATGAGTATATCAAATTTCTACGGTCAATAAGACCAGATAACATGTCTGAGTATAGTAAGCAGATGCAGA
GATTTAATGTTGGAGAAGATTGTCCAGTGTTTGATGGACTCTTTGAGTTTTGTCAGCTCTCAACTGGCGG
TTCAGTTGCTGGAGCTGTGAAGTTAAACCGACAACAGACTGATATGGCTGTTAATTGGGCTGGAGGATTA
CATCATGCTAAGAAATCAGAAGCATCAGGATTCTGTTACGTTAATGATATTGTGCTTGCCATCCTTGAAT
TACTAAAGTATCATCAGAGAGTCTTATATATTGATATAGATATTCATCATGGTGATGGTGTTGAAGAAGC
TTTTTATACAACAGATCGTGTAATGACGGTATCATTCCATAAATATGGGGAATACTTTCCTGGCACAGGA
GACTTGAGGGATATTGGTGCTGGAAAAGGCAAATACTATGCTGTCAATTTTCCAATGAGAGATGGTATAG
ATGATGAGTCATATGGGCAGATATTTAAGCCTATTATCTCAAAGGTGATGGAGATGTATCAACCTAGTGC
TGTGGTATTACAGTGTGGTGCAGACTCATTATCTGGTGATAGACTGGGTTGTTTCAATCTAACAGTCAAA
GGTCATGCTAAATGTGTAGAAGTTGTAAAAACTTTTAACTTACCATTACTGATGCTTGGAGGAGGTGGCT
ACACAATCCGTAATGTTGCTCGATGTTGGACATATGAGACTGCAGTTGCCCTTGATTGTGAGATTCCCAA
TGAGTTGCCATATAATGATTACTTTGAGTATTTTGGACCAGACTTCAAACTGCATATTAGTCCTTCAAAC
ATGACAAACCAGAACACTCCAGAATATATGGAAAAGATAAAACAGCGTTTGTTTGAAAATTTGCGCATGT
TACCTCATGCACCTGGTGTCCAGATGCAAGCTATTCCAGAAGATGCTGTTCATGAAGACAGTGGAGATGA
AGATGGAGAAGATCCAGACAAGAGAATTTCTATTCGAGCATCAGACAAGCGGATAGCTTGTGATGAAGAA
TTCTCAGATTCTGAGGATGAAGGAGAAGGAGGTCGAAGAAATGTGGCTGATCATAAGAAAGGAGCAAAGA
AAGCTAGAATTGAAGAAGATAAGAAAGAAACAGAGGACAAAAAAACAGACGTTAAGGAAGAAGATAAATC
CAAGGACAACAGTGGTGAAAAAACAGATACCAAAGGAACCAAATCAGAACAGCTCAGCAACCCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001527
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone may be unstable or toxic at high copy number in common E. coli strain. We recommend using a lower copy number E. coli strain, such as CopyCutter strain (http://www.epibio.com/item.asp?ID=435) for transformation and plasmid preparation. Please be aware that the DNA yield could be low. Additional aliquots of this clone can be ordered from OriGene.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001527.3, NP_001518.3
RefSeq Size 6656 bp
RefSeq ORF 1467 bp
Locus ID 3066
Cytogenetics 6q21
Domains Hist_deacetyl
Protein Families Druggable Genome, Stem cell - Pluripotency, Transcription Factors
Protein Pathways Cell cycle, Chronic myeloid leukemia, Huntington's disease, Notch signaling pathway, Pathways in cancer
Gene Summary 'This gene product belongs to the histone deacetylase family. Histone deacetylases act via the formation of large multiprotein complexes, and are responsible for the deacetylation of lysine residues at the N-terminal regions of core histones (H2A, H2B, H3 and H4). This protein forms transcriptional repressor complexes by associating with many different proteins, including YY1, a mammalian zinc-finger transcription factor. Thus, it plays an important role in transcriptional regulation, cell cycle progression and developmental events. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]'
Transcript Variant: This variant (1) encodes the functional protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.