HDAC2 (NM_001527) Human Untagged Clone
CAT#: SC318000
HDAC2 (untagged)-Human histone deacetylase 2 (HDAC2), transcript variant 1
"NM_001527" in other vectors (8)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | HDAC2 |
| Synonyms | HD2; KDAC2; RPD3; YAF1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001527, the custom clone sequence may differ by one or more nucleotides
ATGGCGTACAGTCAAGGAGGCGGCAAAAAAAAAGTCTGCTACTACTACGACGGTGATATTGGAAATTATT ATTATGGACAGGGTCATCCCATGAAGCCTCATAGAATCCGCATGACCCATAACTTGCTGTTAAATTATGG CTTATACAGAAAAATGGAAATATATAGGCCCCATAAAGCCACTGCCGAAGAAATGACAAAATATCACAGT GATGAGTATATCAAATTTCTACGGTCAATAAGACCAGATAACATGTCTGAGTATAGTAAGCAGATGCAGA GATTTAATGTTGGAGAAGATTGTCCAGTGTTTGATGGACTCTTTGAGTTTTGTCAGCTCTCAACTGGCGG TTCAGTTGCTGGAGCTGTGAAGTTAAACCGACAACAGACTGATATGGCTGTTAATTGGGCTGGAGGATTA CATCATGCTAAGAAATCAGAAGCATCAGGATTCTGTTACGTTAATGATATTGTGCTTGCCATCCTTGAAT TACTAAAGTATCATCAGAGAGTCTTATATATTGATATAGATATTCATCATGGTGATGGTGTTGAAGAAGC TTTTTATACAACAGATCGTGTAATGACGGTATCATTCCATAAATATGGGGAATACTTTCCTGGCACAGGA GACTTGAGGGATATTGGTGCTGGAAAAGGCAAATACTATGCTGTCAATTTTCCAATGAGAGATGGTATAG ATGATGAGTCATATGGGCAGATATTTAAGCCTATTATCTCAAAGGTGATGGAGATGTATCAACCTAGTGC TGTGGTATTACAGTGTGGTGCAGACTCATTATCTGGTGATAGACTGGGTTGTTTCAATCTAACAGTCAAA GGTCATGCTAAATGTGTAGAAGTTGTAAAAACTTTTAACTTACCATTACTGATGCTTGGAGGAGGTGGCT ACACAATCCGTAATGTTGCTCGATGTTGGACATATGAGACTGCAGTTGCCCTTGATTGTGAGATTCCCAA TGAGTTGCCATATAATGATTACTTTGAGTATTTTGGACCAGACTTCAAACTGCATATTAGTCCTTCAAAC ATGACAAACCAGAACACTCCAGAATATATGGAAAAGATAAAACAGCGTTTGTTTGAAAATTTGCGCATGT TACCTCATGCACCTGGTGTCCAGATGCAAGCTATTCCAGAAGATGCTGTTCATGAAGACAGTGGAGATGA AGATGGAGAAGATCCAGACAAGAGAATTTCTATTCGAGCATCAGACAAGCGGATAGCTTGTGATGAAGAA TTCTCAGATTCTGAGGATGAAGGAGAAGGAGGTCGAAGAAATGTGGCTGATCATAAGAAAGGAGCAAAGA AAGCTAGAATTGAAGAAGATAAGAAAGAAACAGAGGACAAAAAAACAGACGTTAAGGAAGAAGATAAATC CAAGGACAACAGTGGTGAAAAAACAGATACCAAAGGAACCAAATCAGAACAGCTCAGCAACCCCTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001527 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This clone may be unstable or toxic at high copy number in common E. coli strain. We recommend using a lower copy number E. coli strain, such as CopyCutter strain (http://www.epibio.com/item.asp?ID=435) for transformation and plasmid preparation. Please be aware that the DNA yield could be low. Additional aliquots of this clone can be ordered from OriGene. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001527.3, NP_001518.3 |
| RefSeq Size | 6656 bp |
| RefSeq ORF | 1467 bp |
| Locus ID | 3066 |
| Cytogenetics | 6q21 |
| Domains | Hist_deacetyl |
| Protein Families | Druggable Genome, Stem cell - Pluripotency, Transcription Factors |
| Protein Pathways | Cell cycle, Chronic myeloid leukemia, Huntington's disease, Notch signaling pathway, Pathways in cancer |
| Gene Summary | 'This gene product belongs to the histone deacetylase family. Histone deacetylases act via the formation of large multiprotein complexes, and are responsible for the deacetylation of lysine residues at the N-terminal regions of core histones (H2A, H2B, H3 and H4). This protein forms transcriptional repressor complexes by associating with many different proteins, including YY1, a mammalian zinc-finger transcription factor. Thus, it plays an important role in transcriptional regulation, cell cycle progression and developmental events. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]' Transcript Variant: This variant (1) encodes the functional protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| SC110918 | HDAC2 (untagged)-Human histone deacetylase 2 (HDAC2), transcript variant 1 |
USD 820.00 |
|
| SC317003 | HDAC2 (untagged)-Human histone deacetylase 2 (HDAC2), transcript variant 1 |
USD 820.00 |
|
| RC224919 | HDAC2 (Myc-DDK-tagged)-Human histone deacetylase 2 (HDAC2), transcript variant 1 |
USD 812.00 |
|
| RG224919 | HDAC2 (GFP-tagged) - Human histone deacetylase 2 (HDAC2), transcript variant 1 |
USD 500.00 |
|
| RC224919L1 | Lenti ORF clone of Human histone deacetylase 2 (HDAC2), transcript variant 1, Myc-DDK-tagged |
USD 804.00 |
|
| RC224919L2 | Lenti ORF clone of Human histone deacetylase 2 (HDAC2), transcript variant 1, mGFP tagged |
USD 650.00 |
|
| RC224919L3 | Lenti ORF clone of Human histone deacetylase 2 (HDAC2), transcript variant 1, Myc-DDK-tagged |
USD 804.00 |
|
| RC224919L4 | Lenti ORF clone of Human histone deacetylase 2 (HDAC2), transcript variant 1, mGFP tagged |
USD 804.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China