TEN1 (NM_001113324) Human Untagged Clone

CAT#: SC318765

TEN1 (untagged)-Human chromosome 17 open reading frame 106 (C17orf106)


  "NM_001113324" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "TEN1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TEN1
Synonyms C17orf106
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001113324, the custom clone sequence may differ by one or more nucleotides
ATGCTGCCCAAACCTGGGACCTATTACCTCCCCTGGGAGGTTAGTGCAGGCCAAGTTCCT
GATGGGAGCACGCTGAGAACATTTGGCAGGTTGTGCCTCTATGACATGATTCAGTCCAGA
GTAACACTGATGGCTCAGCACGGATCCGATCAGCACCAGGTTCTTGTCTGTACCAAGTTG
GTGGAGCCCTTCCACGCCCAGGTGGGCTCCCTGTACATCGTCCTCGGGGAGCTCCAGCAT
CAGCAGGACAGAGGCTCCGTGGTGAAGGCGCGCGTGCTGACCTGTGTGGAGGGGATGAAC
CTGCCCTTGTTGGAACAAGCCATCCGGGAGCAGAGACTGTACAAGCAGGAGCGGGGCGGC
AGCCAG
Restriction Sites Please inquire     
ACCN NM_001113324
ORF Size 369 bp
Insert Size 1010
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001113324.1, NP_001106795.1
RefSeq Size 1010
RefSeq ORF 369
Locus ID 100134934
Gene Summary C17ORF106, or TEN1, appears to function in a telomere-associated complex with STN1 (OBFC1; MIM 613128) and CTC1 (C17ORF68; MIM 613129) (Miyake et al., 2009 [PubMed 19854130]). [supplied by OMIM, Nov 2009]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.