TEN1 (NM_001113324) Human Untagged Clone
CAT#: SC318765
TEN1 (untagged)-Human chromosome 17 open reading frame 106 (C17orf106)
"NM_001113324" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TEN1 |
Synonyms | C17orf106 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001113324, the custom clone sequence may differ by one or more nucleotides
ATGCTGCCCAAACCTGGGACCTATTACCTCCCCTGGGAGGTTAGTGCAGGCCAAGTTCCT GATGGGAGCACGCTGAGAACATTTGGCAGGTTGTGCCTCTATGACATGATTCAGTCCAGA GTAACACTGATGGCTCAGCACGGATCCGATCAGCACCAGGTTCTTGTCTGTACCAAGTTG GTGGAGCCCTTCCACGCCCAGGTGGGCTCCCTGTACATCGTCCTCGGGGAGCTCCAGCAT CAGCAGGACAGAGGCTCCGTGGTGAAGGCGCGCGTGCTGACCTGTGTGGAGGGGATGAAC CTGCCCTTGTTGGAACAAGCCATCCGGGAGCAGAGACTGTACAAGCAGGAGCGGGGCGGC AGCCAG |
Restriction Sites | Please inquire |
ACCN | NM_001113324 |
ORF Size | 369 bp |
Insert Size | 1010 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001113324.1, NP_001106795.1 |
RefSeq Size | 1010 |
RefSeq ORF | 369 |
Locus ID | 100134934 |
Gene Summary | C17ORF106, or TEN1, appears to function in a telomere-associated complex with STN1 (OBFC1; MIM 613128) and CTC1 (C17ORF68; MIM 613129) (Miyake et al., 2009 [PubMed 19854130]). [supplied by OMIM, Nov 2009] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225063 | TEN1 (Myc-DDK-tagged)-Human chromosome 17 open reading frame 106 (C17orf106) |
USD 420.00 |
|
RG225063 | TEN1 (GFP-tagged) - Human chromosome 17 open reading frame 106 (C17orf106) |
USD 460.00 |
|
RC225063L3 | Lenti-ORF clone of TEN1 (Myc-DDK-tagged)-Human chromosome 17 open reading frame 106 (C17orf106) |
USD 620.00 |
|
RC225063L4 | Lenti-ORF clone of TEN1 (mGFP-tagged)-Human chromosome 17 open reading frame 106 (C17orf106) |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review