PARK7 (NM_001123377) Human Untagged Clone

CAT#: SC318792

PARK7 (untagged)-Human Parkinson disease (autosomal recessive, early onset) 7 (PARK7), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PARK7
• Synonyms: DJ-1; DJ1; GATD2; HEL-S-67p
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001123377, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTTCCAAAAGAGCTCTGGTCATCCTGGCTAAAGGAGCAGAGGAAATGGAGACGGTCATCCCTGTAG
  ATGTCATGAGGCGAGCTGGGATTAAGGTCACCGTTGCAGGCCTGGCTGGAAAAGACCCAGTACAGTGTAG
  CCGTGATGTGGTCATTTGTCCTGATGCCAGCCTTGAAGATGCAAAAAAAGAGGGACCATATGATGTGGTG
  GTTCTACCAGGAGGTAATCTGGGCGCACAGAATTTATCTGAGTCTGCTGCTGTGAAGGAGATACTGAAGG
  AGCAGGAAAACCGGAAGGGCCTGATAGCCGCCATCTGTGCAGGTCCTACTGCTCTGTTGGCTCATGAAAT
  AGGTTTTGGAAGTAAAGTTACAACACACCCTCTTGCTAAAGACAAAATGATGAATGGAGGTCATTACACC
  TACTCTGAGAATCGTGTGGAAAAAGACGGCCTGATTCTTACAAGCCGGGGGCCTGGGACCAGCTTCGAGT
  TTGCGCTTGCAATTGTTGAAGCCCTGAATGGCAAGGAGGTGGCGGCTCAAGTGAAGGCTCCACTTGTTCT
  TAAAGACTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001123377
• ORF Size: 570 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001123377.1, NP_001116849.1
• RefSeq Size: 921
• RefSeq ORF: 570
• Locus ID: 11315
• Protein Families: Druggable Genome, Protease
• Protein Pathways: Parkinson's disease
• Gene Summary: The product of this gene belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Defects in this gene are the cause of autosomal recessive early-onset Parkinson disease 7. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) represents the shorter transcript. Both variants 1 and 2 encode the same protein.