Pregnancy specific beta 1 glycoprotein 11 (PSG11) (NM_001113410) Human Untagged Clone

CAT#: SC318797

PSG11 (untagged)-Human pregnancy specific beta-1-glycoprotein 11 (PSG11), transcript variant 3


  "NM_001113410" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PSG11"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PSG11
Synonyms PSBG-11; PSBG-13; PSG13; PSG14
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001113410, the custom clone sequence may differ by one or more nucleotides


ATGGGGCCCCTCTCAGCCCCTCCCTGCACAGAGCACATCAAATGGAAGGGGCTCCTGCTCACAGTGGAGA
CTCCCAAGCCCTCCATCTCCAGCAGCAACTTAAACCCCAGGGAGGCCATGGAGACTGTGATCTTAACCTG
TAATCCTGAGACTCCGGACGCAAGCTACCTGTGGTGGATGAATGGTCAGAGCCTCCCTATGACTCATAGG
ATGCAGCTGTCTGAAACCAACAGGACCCTCTTTCTATTTGGTGTCACAAAGTATACTGCAGGACCCTATG
AATGTGAAATATGGAACTCAGGGAGTGCCAGCCGCAGTGACCCAGTCACCCTGAATCTCCTCCATGGTCC
AGACCTCCCCAGAATTTTCCCTTCAGTCACCTCTTACTATTCAGGAGAGAACCTCGACTTGTCCTGCTTC
GCAAACTCTAACCCACCAGCACAGTATTCTTGGACAATTAATGGGAAGTTTCAGCTATCAGGACAAAAGC
TCTTTATCCCTCAGATTACTCCAAAGCATAATGGGCTCTATGCTTGCTCTGCTCGTAACTCAGCCACTGG
CGAGGAAAGCTCCACATCCTTGACAATCAGAGTCATTGCTCCTCCAGGATTAGGAACTTTTGCTTTCAAT
AATCCAACGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001113410
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001113410.1, NP_001106881.1
RefSeq Size 1175 bp
RefSeq ORF 642 bp
Locus ID 5680
Cytogenetics 19q13.31
Protein Families Secreted Protein
Gene Summary 'The human pregnancy-specific glycoproteins (PSGs) are a group of molecules that are mainly produced by the placental syncytiotrophoblasts during pregnancy. PSGs comprise a subgroup of the carcinoembryonic antigen (CEA) family, which belongs to the immunoglobulin superfamily. For additional general information about the PSG gene family, see PSG1 (MIM 176390).[supplied by OMIM, Oct 2009]'
Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1. Both variants 2 and 3 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.