Claudin 22 (CLDN22) (NM_001111319) Human Untagged Clone

CAT#: SC318800

CLDN22 (untagged)-Human claudin 22 (CLDN22)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLDN22
• Synonyms: CLDN21
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001111319 edited
  CAGGACATTATAATGGCTTTAGTATTTAGAACTGTAGCTCAACTAGCTGGAGTTTCATTA
  TCTTTGCTGGGATGGGTTTTATCCTGTCTTACAAACTACCTGCCACACTGGAAGAACCTC
  AACCTGGACTTAAATGAAATGGAAAACTGGACCATGGGACTCTGGCAAACCTGTGTCATC
  CAAGAGGAAGTGGGGATGCAATGCAAGGACTTTGACTCCTTCCTGGCTTTGCCTGCTGAA
  CTCAGGGTCTCCAGGATCTTAATGTTTCTGTCAAATGGGCTGGGATTTCTGGGCCTGCTG
  GTCTCTGGGTTTGGCCTGGACTGTTTGAGAATTGGAGAGAGTCAGAGAGATCTCAAGAGG
  CGACTGCTGATCCTGGGAGGAATTCTGTCCTGGGCCTCGGGAGTCACAGCCCTGGTTCCC
  GTCTCTTGGGTTGCCCACAAGACGGTTCAGGAGTTCTGGGATGAGAACGTCCCAGACTTT
  GTCCCCAGGTGGGAGTTTGGGGAGGCCCTGTTTCTGGGCTGGTTTGCTGGACTTTCTCTT
  CTGCTAGGAGGGTGTCTGCTCCACTGTGCAGCCTGCTCCAGCCACGCTCCCCTAGCTTCG
  GGCCACTACGCAGTGGCACAAACACAAGATCATCATCAAGAACTGGAGACGAGAAACACC
  AACCTGAAACACTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001111319
• ORF Size: 663 bp
• Insert Size: 700
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001111319.1, NP_001104789.1
• RefSeq Size: 2708
• RefSeq ORF: 663
• Locus ID: 53842
• Protein Families: Transmembrane
• Protein Pathways: Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction
• Gene Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is intronless and overlaps the 3' UTR of the WWC2 gene (GeneID: 80014) on the opposite strand. [provided by RefSeq, Aug 2010]