RUNX1 (NM_001122607) Human Untagged Clone

CAT#: SC318805

RUNX1 (untagged)-Human runt-related transcription factor 1 (RUNX1), transcript variant 3


  "NM_001122607" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "RUNX1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RUNX1
Synonyms AML1; AML1-EVI-1; AMLCR1; CBF2alpha; CBFA2; EVI-1; PEBP2aB; PEBP2alpha
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001122607 edited
ATGCGTATCCCCGTAGATGCCAGCACGAGCCGCCGCTTCACGCCGCCTTCCACCGCGCTG
AGCCCAGGCAAGATGAGCGAGGCGTTGCCGCTGGGCGCCCCGGACGCCGGCGCTGCCCTG
GCCGGCAAGCTGAGGAGCGGCGACCGCAGCATGGTGGAGGTGCTGGCCGACCACCCGGGC
GAGCTGGTGCGCACCGACAGCCCCAACTTCCTCTGCTCCGTGCTGCCTACGCACTGGCGC
TGCAACAAGACCCTGCCCATCGCTTTCAAGGTGGTGGCCCTAGGGGATGTTCCAGATGGC
ACTCTGGTCACTGTGATGGCTGGCAATGATGAAAACTACTCGGCTGAGCTGAGAAATGCT
ACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGACCTCAGGTTTGTCGGTCGAAGT
GGAAGAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCC
ACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAGACATCGG
CAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCCTTTTCCGAGCGGCTCAGTGAA
CTGGAGCAGCTGCGGCGCACAGCCATGAGGGTCAGCCCACACCACCCAGCCCCCACGCCC
AACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAACCCTCAGCCTCAGAGTCAGATG
CAGGAGGAAGACACAGCACCCTGGAGATGTTAA
Restriction Sites Please inquire     
ACCN NM_001122607
Insert Size 800 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001122607.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001122607.1, NP_001116079.1
RefSeq Size 2722 bp
RefSeq ORF 753 bp
Locus ID 861
Cytogenetics 21q22.12
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors
Protein Pathways Acute myeloid leukemia, Chronic myeloid leukemia, Pathways in cancer
Gene Summary 'Core binding factor (CBF) is a heterodimeric transcription factor that binds to the core element of many enhancers and promoters. The protein encoded by this gene represents the alpha subunit of CBF and is thought to be involved in the development of normal hematopoiesis. Chromosomal translocations involving this gene are well-documented and have been associated with several types of leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (3) differs in the 5' UTR and coding region as well as the 3' UTR and coding region compared to variant 1. The resulting isoform (AML1a) is shorter and has distinct N- and C-termini compared to isoform AML1c.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.