MTRF1L (NM_001114184) Human Untagged Clone

CAT#: SC318814

MTRF1L (untagged)-Human mitochondrial translational release factor 1-like (MTRF1L), nuclear gene encoding mitochondrial protein, transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MTRF1L
• Synonyms: HMRF1L; MRF1L; mtRF1a
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001114184, the custom clone sequence may differ by one or more nucleotides
  ATGCGGTCCCGGGTTCTGTGGGGCGCTGCCCGGTGGCTCTGGCCCCGCCGGGCCGTTGGC
  CCAGCCCGCCGGCCCCTGAGCTCCGGTAGCCCGCCGCTGGAGGAGCTGTTCACCCGGGGC
  GGGCCCTTGCGGACCTTCCTCGAGCGCCAGGCGGGGTCTGAAGCCCATTTGAAGGTCAGG
  AGGCCCGAGTTGCTGGCGGTGATCAAACTGCTGAACGAGAAGGAGCGGGAGCTGCGGGAG
  ACTGAGCACTTGCTGCACGATGAGAATGAAGATTTAAGGAAACTTGCAGAGAATGAAATC
  ACTTTGTGTCAAAAAGAAATAACTCAGCTGAAGCATCAGATTATCTTACTTTTGGTTCCC
  TCAGAAGAAACAGATGAAAATGATTTGATCCTGGAAGTAACTGCAGGAGTTGGAGGTCAG
  GAGGCAATGTTGTTTACATCAGAGATATTTGATATGTATCAGCAATATGCTGCATTTAAA
  AGATGGCATTTTGAAACCCTGGAATATTTTCCAAGTGAACTAGGTGGCCTTAGACATGCA
  TCTGCCAGCATTGGGGGTTCAGAAGCCTATAGGCACATGAAATTTGAAGGAGGTGTTCAC
  AGAGTACAAAGAGTGCCAAAGACAGAAAAGCAAGGCCGCGTCCATACTAGCACCATGACT
  GTAGCAATATTACCCCAGCCTACTGAGATTAATCTGGTGATTAATCCGAAAGATTTGAGA
  ATTGACACTAAGCGAGCCAGTGGAGCTGGGGGGCAGCATGTAAATACCACGGACAGTGCT
  GTCCGGATAGTTCATCTTCCAACAGATTGGAAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001114184
• ORF Size: 816 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001114184.1, NP_001107656.1
• RefSeq Size: 3741
• RefSeq ORF: 816
• Locus ID: 54516
• Gene Summary: The protein encoded by this gene plays a role in mitochondrial translation termination, and is thought to be a release factor that is involved in the dissociation of the complete protein from the final tRNA, the ribosome, and the cognate mRNA. This protein acts upon UAA and UAG stop codons, but has no in vitro activity against UGA, which encodes tryptophan in human mitochondrion, or, the mitochondrial non-cognate stop codons, AGA and AGG. This protein shares sequence similarity to bacterial release factors. Pseudogenes of this gene are found on chromosomes 4, 8, and 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
  Transcript Variant: This variant (3) lacks an alternate exon in the 3' coding region, which results in a frameshift and an early stop codon, compared to variant 1. This variant encodes isoform 3, which is shorter and has a distinct C-terminus, compared to isoform 1.