Trypsin (PRSS3) (NM_007343) Human Untagged Clone
CAT#: SC318823
PRSS3 (untagged)-Human protease, serine, 3 (PRSS3), transcript variant 1
"NM_007343" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PRSS3 |
Synonyms | MTG; PRSS4; T9; TRY3; TRY4 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_007343 edited
CCTCTCCTGAAGCACACAGCCTAGGGAGTTCCTGGGGCCAGAGACATCTCCAAGGGAAGG TCAAGGGCCTGGAGGATGTGCGGACCTGACGACAGATGCCCCGCACGCTGGCCGGGACCG GGAAGGGCGGTCAAGTGTGGAAAGGGTCTGGCGGCTGCCAGGCCTGGCAGAGTGGAGCGG GGCGGGGCGCAGCGGGGCGGGGCGGGCCTGGAGCTGCACCCGCTTCTGGGTGGACGCACT TGGCGAGCGGCGCGGGATGCAGACGGCTGCGAGGCGCTGGGCACAGTTGCTGTCCCCTTT GACGATGATGACAAGATTGTTGGGGGCTACACCTGTGAGGAGAATTCTCTCCCCTACCAG GTGTCCCTGAATTCTGGCTCCCACTTCTGCGGTGGCTCCCTCATCAGCGAACAGTGGGTG GTATCAGCAGCTCACTGCTACAAGACCCGCATCCAGGTGAGACTGGGAGAGCACAACATC AAAGTCCTGGAGGGGAATGAGCAGTTCATCAATGCGGCCAAGATCATCCGCCACCCTAAA TACAACAGGGACACTCTGGACAATGACATCATGCTGATCAAACTCTCCTCACCTGCCGTC ATCAATGCCCGCGTGTCCACCATCTCTCTGCCCACCGCCCCTCCAGCTGCTGGCACTGAG TGCCTCATCTCCGGCTGGGGCAACACTCTGAGCTTTGGTGCTGACTACCCAGACGAGCTG AAGTGCCTGGATGCTCCGGTGCTGACCCAGGCTGAGTGTAAAGCCTCCTACCCTGGAAAG ATTACCAACAGCATGTTCTGTGTGGGCTTCCTTGAGGGAGGCAAGGATTCCTGCCAGCGT GACTCTGGTGGCCCTGTGGTCTGCAACGGACAGCTCCAAGGAGTTGTCTCCTGGGGCCAT GGCTGTGCCTGGAAGAACAGGCCTGGAGTCTACACCAAGGTCTACAACTATGTGGACTGG ATTAAGGACACCATCGCTGCCAACAGCTAA |
Restriction Sites | Please inquire |
ACCN | NM_007343 |
Insert Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_007343.2, NP_031369.2 |
RefSeq Size | 981 bp |
RefSeq ORF | 915 bp |
Locus ID | 5646 |
Cytogenetics | 9p13.3 |
Protein Families | Druggable Genome, Protease, Secreted Protein |
Protein Pathways | Neuroactive ligand-receptor interaction |
Gene Summary | 'This gene encodes a trypsinogen, which is a member of the trypsin family of serine proteases. This enzyme is expressed in the brain and pancreas and is resistant to common trypsin inhibitors. It is active on peptide linkages involving the carboxyl group of lysine or arginine. This gene is localized to the locus of T cell receptor beta variable orphans on chromosome 9. Four transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2010]' Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225426 | PRSS3 (Myc-DDK-tagged)-Human protease, serine, 3 (PRSS3), transcript variant 1 |
USD 420.00 |
|
RG225426 | PRSS3 (GFP-tagged) - Human protease, serine, 3 (PRSS3), transcript variant 1 |
USD 460.00 |
|
RC225426L3 | Lenti ORF clone of Human protease, serine, 3 (PRSS3), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC225426L4 | Lenti ORF clone of Human protease, serine, 3 (PRSS3), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review