ALP (PDLIM3) (NM_001114107) Human Untagged Clone

CAT#: SC318828

PDLIM3 (untagged)-Human PDZ and LIM domain 3 (PDLIM3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PDLIM3
• Synonyms: ALP
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001114107, the custom clone sequence may differ by one or more nucleotides
  ATGCCCCAGACGGTGATCCTCCCGGGCCCTGCGCCCTGGGGCTTCAGGCTCTCAGGGGGC
  ATAGACTTCAACCAGCCTTTGGTCATCACCAGGATTACACCAGGAAGCAAGGCGGCAGCT
  GCCAACCTGTGTCCTGGAGATGTCATCCTGGCTATTGACGGCTTTGGGACAGAGTCCATG
  ACTCATGCTGATGCGCAGGACAGGATTAAAGCAGCAGCTCACCAGCTGTGTCTCAAAATT
  GACAGGGGAGAAACTCACTTATGGTCTCCACAAGTATCTGAAGATGGGAAAGCCCATCCT
  TTCAAAATCAACTTAGAATCAGAACCACAGGAATTCAAACCCATTGGTACCGCGCACAAC
  AGAAGGGCCCAGCCTTTTGTTGCAGCTGCAAACATTGATGACAAAAGACAGGTAGTGAGC
  GCTTCCTATAACTCGCCAATTGGGCTCTATTCAACTAGCAATATACAAGATGCGCTTCAC
  GGACAGCTGCGGGGTCTCATTCCTAGCTCACCTCAAAACGAGCCCACAGCCTCGGTGCCC
  CCCGAGTCGGACGTGTACCGGATGCTCCACGACAATCGGAATGAGCCCACACAGCCTCGC
  CAGTCGGGCTCCTTCAGAGTGCTCCAGGGAATGGTGGACGATGGCTCTGATGACCGTCCG
  GCTGGAACGCGGAGTGTGAGAGCTCCGGTGACGAAAGTCCATGGCGGTTCAGGCGGGGCA
  CAGAGGATGCCGCTCTGTGACAAATGTGGGAGTGGCATAGTCGGTGCTGTGGTGAAGGCG
  CGGGATAAGTACCGGCACCCTGAGTGCTTCGTGTGTGCCGACTGCAACCTCAACCTCAAG
  CAAAAGGGCTACTTCTTCATAGAAGGGGAGCTGTACTGCGAAACCCACGCAAGAGCCCGC
  ACAAAGCCCCCAGAGGGCTATGACACGGTCACTCTGTATCCCAAAGCT
  
• Restriction Sites: Please inquire
• ACCN: NM_001114107
• ORF Size: 2709 bp
• Insert Size: 2709
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001114107.1, NP_001107579.1
• RefSeq Size: 2709
• RefSeq ORF: 2709
• Locus ID: 27295
• Gene Summary: The protein encoded by this gene contains a PDZ domain and a LIM domain, indicating that it may be involved in cytoskeletal assembly. In support of this, the encoded protein has been shown to bind the spectrin-like repeats of alpha-actinin-2 and to colocalize with alpha-actinin-2 at the Z lines of skeletal muscle. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Aberrant alternative splicing of this gene may play a role in myotonic dystrophy. [provided by RefSeq, Apr 2012]
  Transcript Variant: This variant (2) lacks two consecutive exons in the coding region and contains an alternate coding exon, but maintains the reading frame, compared to variant 1. The encoded isoform (b) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.