HRH2 (NM_022304) Human Untagged Clone

CAT#: SC318837

HRH2 (untagged)-Human histamine receptor H2 (HRH2), transcript variant 2


  "NM_022304" in other vectors (4)

Reconstitution Protocol

SC318837 is the updated version of SC313118.

USD 610.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "HRH2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HRH2
Synonyms H2R
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC318837 representing NM_022304
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCACCCAATGGCACAGCCTCTTCCTTTTGCCTGGACTCTACCGCATGCAAGATCACCATCACCGTGG
TCCTTGCGGTCCTCATCCTCATCACCGTTGCTGGCAATGTGGTCGTCTGTCTGGCCGTGGGCTTGAACCG
CCGGCTCCGCAACCTGACCAATTGTTTCATCGTGTCCTTGGCTATCACTGACCTGCTCCTCGGCCTCCTG
GTGCTGCCCTTCTCTGCCATCTACCAGCTGTCCTGCAAGTGGAGCTTTGGCAAGGTCTTCTGCAATATCT
ACACCAGCCTGGATGTGATGCTCTGCACAGCCTCCATTCTTAACCTCTTCATGATCAGCCTCGACCGGTA
CTGCGCTGTCATGGACCCACTGCGGTACCCTGTGCTGGTCACCCCAGTTCGGGTCGCCATCTCTCTGGTC
TTAATTTGGGTCATCTCCATTACCCTGTCCTTTCTGTCTATCCACCTGGGGTGGAACAGCAGGAACGAGA
CCAGCAAGGGCAATCATACCACCTCTAAGTGCAAAGTCCAGGTCAATGAAGTGTACGGGCTGGTGGATGG
GCTGGTCACCTTCTACCTCCCGCTACTGATCATGTGCATCACCTACTACCGCATCTTCAAGGTCGCCCGG
GATCAGGCCAAGAGGATCAATCACATTAGCTCCTGGAAGGCAGCCACCATCAGGGAGCACAAAGCCACAG
TGACACTGGCCGCCGTCATGGGGGCCTTCATCATCTGCTGGTTTCCCTACTTCACCGCGTTTGTGTACCG
TGGGCTGAGAGGGGATGATGCCATCAATGAGGTGTTAGAAGCCATCGTTCTGTGGCTGGGCTATGCCAAC
TCAGCCCTGAACCCCATCCTGTATGCTGCGCTGAACAGAGACTTCCGCACCGGGTACCAACAGCTCTTCT
GCTGCAGGCTGGCCAACCGCAACTCCCACAAAACTTCTCTGAGGTCCAACGCCTCTCAGCTGTCCAGGAC
CCAAAGCCGAGAACCCAGGCAACAGGAAGAGAAACCCCTGAAGCTCCAGGTGTGGAGTGGGACAGAAGTC
ACGGCCCCCCAGGGAGCCACAGACAGGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites Please inquire     
ACCN NM_022304
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_022304.1, NP_071640.1
RefSeq Size 1847 bp
RefSeq ORF 1080 bp
Locus ID 3274
Cytogenetics 5q35.2
Domains 7tm_1
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction
Gene Summary 'Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. Histamine receptor H2 belongs to the family 1 of G protein-coupled receptors. It is an integral membrane protein and stimulates gastric acid secretion. It also regulates gastrointestinal motility and intestinal secretion and is thought to be involved in regulating cell growth and differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]'
Transcript Variant: This variant (2) is intronless and encodes isoform 2, which has a truncated C-terminus, as compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.