GDI2 (NM_001115156) Human Untagged Clone
CAT#: SC318857
GDI2 (untagged)-Human GDP dissociation inhibitor 2 (GDI2), transcript variant 2
"NM_001115156" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GDI2 |
Synonyms | HEL-S-46e; RABGDIB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001115156, the custom clone sequence may differ by one or more nucleotides
ATGAATGAGGAGTACGACGTGATCGTGCTGGGCACCGGCCTGACGGAATGTATCCTGTCAGGTATAATGT CAGTGAATGGCAAGAAAGTTCTTCATATGGATCGAAACCCTTACTACGGAGGAGAGAGTGCATCTATAAC ACCATTGGAAGATTTATACAAAAGATTTAAAATACCAGGATCACCACCCGAGTCAATGGGGAGAGGAAGA GACTGGAATGTTGACTTGATTCCCAAGTTCCTTATGGCTAATGGCCTAATGGGATTGTTTGAAAAACGTC GCTTCAGGAAATTCCTAGTGTATGTTGCCAACTTCGATGAAAAAGATCCAAGAACTTTTGAAGGCATTGA TCCTAAGAAGACCACAATGCGAGATGTGTATAAGAAATTTGATTTGGGTCAAGACGTTATAGATTTTACT GGTCATGCTCTTGCACTTTACAGAACTGATGATTACTTAGATCAACCGTGTTATGAAACCATTAATAGAA TTAAACTTTACAGTGAATCTTTGGCAAGATATGGCAAAAGCCCATACCTTTATCCACTCTATGGCCTTGG AGAACTGCCCCAAGGATTTGCAAGGCTAAGTGCTATTTATGGAGGTACCTATATGCTGAATAAACCCATT GAAGAAATCATTGTACAGAATGGAAAAGTAATTGGTGTAAAATCTGAAGGAGAAATTGCTCGCTGTAAGC AGCTCATCTGTGACCCCAGCTACGTAAAAGATCGGGTAGAAAAAGTGGGCCAGGTGATCAGAGTTATTTG CATCCTCAGCCACCCCATCAAGAACACCAATGATGCCAACTCCTGCCAGATCATTATTCCACAGAACCAA GTCAATCGAAAGTCAGATATCTACGTCTGCATGATCTCCTTTGCGCACAATGTAGCAGCACAAGGGAAGT ACATTGCTATAGTTAGTACAACTGTGGAAACCAAGGAGCCTGAGAAGGAAATCAGACCAGCTTTGGAGCT CTTGGAACCAATTGAACAGAAATTTGTTAGCATCAGTGACCTCCTGGTACCAAAAGACTTGGGAACAGAA AGCCAGATCTTTATTTCCCGCACATATGATGCCACCACTCATTTTGAGACAACGTGTGATGACATTAAAA ACATCTATAAGAGGATGACAGGATCAGAGTTTGACTTTGAGGAAATGAAGCGCAAGAAGAATGACATCTA TGGGGAAGACTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001115156 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001115156.1, NP_001108628.1 |
RefSeq Size | 2306 bp |
RefSeq ORF | 1203 bp |
Locus ID | 2665 |
Cytogenetics | 10p15.1 |
Gene Summary | 'GDP dissociation inhibitors are proteins that regulate the GDP-GTP exchange reaction of members of the rab family, small GTP-binding proteins of the ras superfamily, that are involved in vesicular trafficking of molecules between cellular organelles. GDIs slow the rate of dissociation of GDP from rab proteins and release GDP from membrane-bound rabs. GDI2 is ubiquitously expressed. The GDI2 gene contains many repetitive elements indicating that it may be prone to inversion/deletion rearrangements. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (2) lacks an in-frame exon in the 5' coding region, compared to variant 1, resulting in a shorter protein, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225625 | GDI2 (Myc-DDK-tagged)-Human GDP dissociation inhibitor 2 (GDI2), transcript variant 2 |
USD 420.00 |
|
RG225625 | GDI2 (GFP-tagged) - Human GDP dissociation inhibitor 2 (GDI2), transcript variant 2 |
USD 460.00 |
|
RC225625L3 | Lenti-ORF clone of GDI2 (Myc-DDK-tagged)-Human GDP dissociation inhibitor 2 (GDI2), transcript variant 2 |
USD 620.00 |
|
RC225625L4 | Lenti-ORF clone of GDI2 (mGFP-tagged)-Human GDP dissociation inhibitor 2 (GDI2), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review