LAMP2 (NM_001122606) Human Untagged Clone
CAT#: SC318864
LAMP2 (untagged)-Human lysosomal-associated membrane protein 2 (LAMP2), transcript variant C
"NM_001122606" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | LAMP2 |
| Synonyms | CD107b; LAMP-2; LAMPB; LGP-96; LGP110 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001122606, the custom clone sequence may differ by one or more nucleotides
ATGGTGTGCTTCCGCCTCTTCCCGGTTCCGGGCTCAGGGCTCGTTCTGGTCTGCCTAGTCCTGGGAGCTG TGCGGTCTTATGCATTGGAACTTAATTTGACAGATTCAGAAAATGCCACTTGCCTTTATGCAAAATGGCA GATGAATTTCACAGTACGCTATGAAACTACAAATAAAACTTATAAAACTGTAACCATTTCAGACCATGGC ACTGTGACATATAATGGAAGCATTTGTGGGGATGATCAGAATGGTCCCAAAATAGCAGTGCAGTTCGGAC CTGGCTTTTCCTGGATTGCGAATTTTACCAAGGCAGCATCTACTTATTCAATTGACAGCGTCTCATTTTC CTACAACACTGGTGATAACACAACATTTCCTGATGCTGAAGATAAAGGAATTCTTACTGTTGATGAACTT TTGGCCATCAGAATTCCATTGAATGACCTTTTTAGATGCAATAGTTTATCAACTTTGGAAAAGAATGATG TTGTCCAACACTACTGGGATGTTCTTGTACAAGCTTTTGTCCAAAATGGCACAGTGAGCACAAATGAGTT CCTGTGTGATAAAGACAAAACTTCAACAGTGGCACCCACCATACACACCACTGTGCCATCTCCTACTACA ACACCTACTCCAAAGGAAAAACCAGAAGCTGGAACCTATTCAGTTAATAATGGCAATGATACTTGTCTGC TGGCTACCATGGGGCTGCAGCTGAACATCACTCAGGATAAGGTTGCTTCAGTTATTAACATCAACCCCAA TACAACTCACTCCACAGGCAGCTGCCGTTCTCACACTGCTCTACTTAGACTCAATAGCAGCACCATTAAG TATCTAGACTTTGTCTTTGCTGTGAAAAATGAAAACCGATTTTATCTGAAGGAAGTGAACATCAGCATGT ATTTGGTTAATGGCTCCGTTTTCAGCATTGCAAATAACAATCTCAGCTACTGGGATGCCCCCCTGGGAAG TTCTTATATGTGCAACAAAGAGCAGACTGTTTCAGTGTCTGGAGCATTTCAGATAAATACCTTTGATCTA AGGGTTCAGCCTTTCAATGTGACACAAGGAAAGTATTCTACAGCTGAAGAATGTTCTGCTGACTCTGACC TCAACTTTCTTATTCCTGTTGCAGTGGGTGTGGCCTTGGGCTTCCTTATAATTGTTGTCTTTATCTCTTA TATGATTGGAAGAAGGAAAAGTCGTACTGGTTATCAGTCTGTGTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001122606 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001122606.1, NP_001116078.1 |
| RefSeq Size | 3767 bp |
| RefSeq ORF | 1236 bp |
| Locus ID | 3920 |
| Cytogenetics | Xq24 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Transmembrane |
| Protein Pathways | Lysosome |
| Gene Summary | 'The protein encoded by this gene is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. It may play a role in tumor cell metastasis. It may also function in the protection, maintenance, and adhesion of the lysosome. Alternative splicing of this gene results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (C) results from alternative splicing of exon 9 and results in a shorter transcript, but longer protein, as compared to variant A. Variant C encodes isoform C. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225644 | LAMP2 (Myc-DDK-tagged)-Human lysosomal-associated membrane protein 2 (LAMP2), transcript variant C |
USD 420.00 |
|
| RG225644 | LAMP2 (GFP-tagged) - Human lysosomal-associated membrane protein 2 (LAMP2), transcript variant C |
USD 460.00 |
|
| RC225644L3 | Lenti ORF clone of Human lysosomal-associated membrane protein 2 (LAMP2), transcript variant C, Myc-DDK-tagged |
USD 620.00 |
|
| RC225644L4 | Lenti ORF clone of Human lysosomal-associated membrane protein 2 (LAMP2), transcript variant C, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China