Adenylosuccinate Lyase (ADSL) (NM_001123378) Human Untagged Clone
CAT#: SC318873
ADSL (untagged)-Human adenylosuccinate lyase (ADSL), transcript variant 2
"NM_001123378" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ADSL |
Synonyms | AMPS; ASASE; ASL |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001123378, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCTGGAGGCGATCATGGTTCGCCCGACAGCTACCGCTCACCTCTTGCCTCCCGCTATGCCAGCC CGGAGATGTGCTTCGTGTTTAGCGACAGGTATAAATTCCGGACATGGCGGCAGCTGTGGCTGTGGCTGGC GGAGGCCGAGCAGACATTGGGTTTGCCTATCACAGATGAACAAATCCAGGAGATGAAATCAAACCTGGAG AACATCGACTTCAAGATGGCAGCTGAGGAAGAGAAACGTTTACGACATGATGTGATGGCTCACGTGCACA CATTTGGCCACTGCTGTCCAAAAGCTGCAGGCATTATTCACCTTGGTGCTACTTCTTGCTATGTTGGAGA CAATACTGACTTGATTATTCTTAGAAATGCACTTGACCTGCTTTTGCCAAAGCTTGCCAGAGTGATCTCT CGGCTTGCCGACTTTGCTAAGGAACGAGCCAGTCTACCCACATTAGGTTTCACACATTTCCAGCCTGCAC AGCTGACCACAGTTGGGAAACGTTGCTGTCTTTGGATTCAGGATCTTTGCATGGATCTCCAGAACTTGAA GCGTGTCCGAGATGACCTGCGCTTCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCAG CTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCTTGACAAGATGGTGACAGAAAAGGCAGGATTTAAGA GAGCTTTCATCATCACAGGGCAGACATATACACGAAAAGTGGATATTGAAGTACTGTCTGTGCTGGCTAG CTTGGGGGCATCAGTGCACAAGATTTGCACCGACATACGCCTCCTGGCAAACCTCAAGGAGATGGAGGAA CCCTTTGAAAAACAGCAGATTGGCTCAAGTGCGATGCCATATAAGCGGAATCCCATGCGTTCAGAACGTT GCTGCAGTCTTGCCCGCCACCTGATGACCCTTGTCATGGACCCGCTACAGACAGCATCTGTCCAGTGGTT TGAACGCACACTGGATGATAGTGCCAACCGACGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGATACT ATATTGAATACGCTGCAGAACATTTCTGAAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGCGCATTC GGCAAGAGCTGCCTTTCATGGCCACAGAGAACATCATCATGGCCATGGTCAAAGCTGGAGGTAGCCGCCA GGTGCAGAGATTCTTAGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAA GCAGAATTATGTCTGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001123378 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001123378.2, NP_001116850.1 |
RefSeq Size | 1580 bp |
RefSeq ORF | 1278 bp |
Locus ID | 158 |
Cytogenetics | 22q13.1 |
Protein Families | Druggable Genome |
Protein Pathways | Alanine, aspartate and glutamate metabolism, Metabolic pathways, Purine metabolism |
Gene Summary | 'The protein encoded by this gene belongs to the lyase 1 family. It is an essential enzyme involved in purine metabolism, and catalyzes two non-sequential reactions in the de novo purine biosynthetic pathway: the conversion of succinylaminoimidazole carboxamide ribotide (SAICAR) to aminoimidazole carboxamide ribotide (AICAR) and the conversion of adenylosuccinate (S-AMP) to adenosine monophosphate (AMP). Mutations in this gene are associated with adenylosuccinase deficiency (ADSLD), a disorder marked with psychomotor retardation, epilepsy or autistic features. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]' Transcript Variant: This variant (2) lacks the penultimate, in-frame coding exon compared to variant 1. The resulting isoform (b) is shorter, missing an internal protein segment compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225694 | ADSL (Myc-DDK-tagged)-Human adenylosuccinate lyase (ADSL), transcript variant 2 |
USD 420.00 |
|
RG225694 | ADSL (GFP-tagged) - Human adenylosuccinate lyase (ADSL), transcript variant 2 |
USD 460.00 |
|
RC225694L3 | Lenti-ORF clone of ADSL (Myc-DDK-tagged)-Human adenylosuccinate lyase (ADSL), transcript variant 2 |
USD 620.00 |
|
RC225694L4 | Lenti-ORF clone of ADSL (mGFP-tagged)-Human adenylosuccinate lyase (ADSL), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review