ELK1 (NM_001114123) Human Untagged Clone

CAT#: SC318874

ELK1 (untagged)-Human ELK1, member of ETS oncogene family (ELK1), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ELK1
• Synonyms: ELK1 protein; ELK1, member of ETS oncogene family; ETS-like gene 1; OTTHUMP00000023224; OTTHUMP00000023225
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_005229, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACCCATCTGTGACGCTGTGGCAGTTTCTGCTGCAGCTGCTGAGAGAGCAAGGCAATGGCCACATCA
  TCTCCTGGACTTCACGGGATGGTGGTGAATTCAAGCTGGTGGATGCAGAGGAGGTGGCCCGGCTGTGGGG
  GCTACGCAAGAACAAGACCAACATGAATTACGACAAGCTCAGCCGGGCCTTGCGGTACTACTATGACAAG
  AACATCATCCGCAAGGTGAGCGGCCAGAAGTTCGTCTACAAGTTTGTGTCCTACCCTGAGGTCGCAGGGT
  GCTCCACTGAGGACTGCCCGCCCCAGCCAGAGGTGTCTGTTACCTCCACCATGCCAAATGTGGCCCCTGC
  TGCTATACATGCCGCCCCAGGGGACACTGTCTCTGGAAAGCCAGGCACACCCAAGGGTGCAGGAATGGCA
  GGCCCAGGCGGTTTGGCACGCAGCAGCCGGAACGAGTACATGCGCTCGGGCCTCTATTCCACCTTCACCA
  TCCAGTCTCTGCAGCCGCAGCCACCCCCTCATCCTCGGCCTGCTGTGGTGCTCCCCAGTGCAGCTCCTGC
  AGGGGCAGCAGCGCCCCCCTCGGGGAGCAGGAGCACCAGTCCAAGCCCCTTGGAGGCCTGTCTGGAGGCT
  GAAGAGGCCGGCTTGCCTCTGCAGGTCATCCTGACCCCGCCCGAGGCCCCAAACCTGAAATCGGAAGAGC
  TTAATGTGGAGCCGGGTTTGGGCCGGGCTTTGCCCCCAGAAGTGAAAGTAGAAGGGCCCAAGGAAGAGTT
  GGAAGTTGCGGGGGAGAGAGGGTTTGTGCCAGAAACCACCAAGGCCGAGCCAGAAGTCCCTCCACAGGAG
  GGCGTGCCAGCCCGGCTGCCCGCGGTTGTTATGGACACCGCAGGGCAGGCGGGCGGCCATGCGGCTTCCA
  GCCCTGAGATCTCCCAGCCGCAGAAGGGCCGGAAGCCCCGGGACCTAGAGCTTCCACTCAGCCCGAGCCT
  GCTAGGTGGGCCGGGACCCGAACGGACCCCAGGATCGGGAAGTGGCTCCGGCCTCCAGGCTCCGGGGCCG
  GCGCTGACCCCATCCCTGCTTCCTACGCATACATTGACCCCGGTGCTGCTGACACCCAGCTCGCTGCCTC
  CTAGCATTCACTTCTGGAGCACCCTGAGTCCCATTGCGCCCCGTAGCCCGGCCAAGCTCTCCTTCCAGTT
  TCCATCCAGTGGCAGCGCCCAGGTGCACATCCCTTCTATCAGCGTGGATGGCCTCTCGACCCCCGTGGTG
  CTCTCCCCAGGGCCCCAGAAGCCATGA
  
  
• Restriction Sites: NotI-NotI
• ACCN: NM_001114123
• Insert Size: 2800 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_001114123.1.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001114123.1, NP_001107595.1
• RefSeq Size: 2934 bp
• RefSeq ORF: 2934 bp
• Locus ID: 2002
• Cytogenetics: Xp11.23
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: Endometrial cancer, ErbB signaling pathway, Focal adhesion, GnRH signaling pathway, Insulin signaling pathway, MAPK signaling pathway, Prion diseases
• Gene Summary: 'This gene is a member of the Ets family of transcription factors and of the ternary complex factor (TCF) subfamily. Proteins of the TCF subfamily form a ternary complex by binding to the the serum response factor and the serum response element in the promoter of the c-fos proto-oncogene. The protein encoded by this gene is a nuclear target for the ras-raf-MAPK signaling cascade. This gene produces multiple isoforms by using alternative translational start codons and by alternative splicing. Related pseudogenes have been identified on chromosomes 7 and 14. [provided by RefSeq, Mar 2012]'
  Transcript Variant: This variant (1, also known as 5'UTR long or 5'UTRL) represents the longest transcript and encodes the longer isoform (a). Both variants 1 and 2 encode isoform a. Delayed translational reinitiation from an alternative downstream start codon, AUG sElk-1, can also result in a shorter isoform (sELK-1), as described in PMID:22354998.